NM_001904.4:c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG

Variant names:

• chr3-41224574-CTGTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGG-C
• rs121913416
• NM_001904.4:c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG

Variant summary

Our verdict is Uncertain significance. The variant received 3 ACMG points: 3P and 0B. PM4 PP3

The NM_001904.4(CTNNB1):​c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG​(p.Val22_Gly38del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: CTNNB1 NM_001904.4 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 10.0
• Publications: 10 publications found

Genes affected

CTNNB1 (HGNC:2514): (catenin beta 1) The protein encoded by this gene is part of a complex of proteins that constitute adherens junctions (AJs). AJs are necessary for the creation and maintenance of epithelial cell layers by regulating cell growth and adhesion between cells. The encoded protein also anchors the actin cytoskeleton and may be responsible for transmitting the contact inhibition signal that causes cells to stop dividing once the epithelial sheet is complete. Finally, this protein binds to the product of the APC gene, which is mutated in adenomatous polyposis of the colon. Mutations in this gene are a cause of colorectal cancer (CRC), pilomatrixoma (PTR), medulloblastoma (MDB), and ovarian cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]

CTNNB1 Gene-Disease associations (from GenCC):

• exudative vitreoretinopathy

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
• severe intellectual disability-progressive spastic diplegia syndrome

  Inheritance: Unknown, AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P, Labcorp Genetics (formerly Invitae), Illumina, Ambry Genetics
• exudative vitreoretinopathy 7

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics

ACMG classification

Our verdict: Uncertain_significance. The variant received 3 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001904.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001904.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTNNB1	NM_001904.4	MANE Select	c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG	p.Val22_Gly38del	disruptive_inframe_deletion	Exon 3 of 15	NP_001895.1	P35222
	CTNNB1	NM_001098209.2		c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG	p.Val22_Gly38del	disruptive_inframe_deletion	Exon 3 of 16	NP_001091679.1	P35222
	CTNNB1	NM_001098210.2		c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG	p.Val22_Gly38del	disruptive_inframe_deletion	Exon 3 of 16	NP_001091680.1	P35222

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTNNB1	ENST00000349496.11	TSL:1 MANE Select	c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG	p.Val22_Gly38del	disruptive_inframe_deletion	Exon 3 of 15	ENSP00000344456.5	P35222
	CTNNB1	ENST00000396183.7	TSL:1	c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG	p.Val22_Gly38del	disruptive_inframe_deletion	Exon 3 of 16	ENSP00000379486.3	P35222
	CTNNB1	ENST00000396185.8	TSL:1	c.65_115delTTAGTCACTGGCAGCAACAGTCTTACCTGGACTCTGGAATCCATTCTGGTG	p.Val22_Gly38del	disruptive_inframe_deletion	Exon 3 of 16	ENSP00000379488.3	P35222

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		10

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs121913416; hg19: chr3-41266065; COSMIC: COSV62714264;