NM_002156.5:c.606+42_606+65dupTATGATCAAAAGTTTGAGTTATCT
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_002156.5(HSPD1):c.606+42_606+65dupTATGATCAAAAGTTTGAGTTATCT variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_002156.5 intron
Scores
Clinical Significance
Conservation
Publications
- hereditary spastic paraplegia 13Inheritance: AD Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- hypomyelinating leukodystrophy 4Inheritance: AR Classification: STRONG, SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), G2P, Orphanet, Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_002156.5. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| HSPD1 | TSL:1 MANE Select | c.606+42_606+65dupTATGATCAAAAGTTTGAGTTATCT | intron | N/A | ENSP00000373620.3 | P10809-1 | |||
| HSPD1 | c.654+42_654+65dupTATGATCAAAAGTTTGAGTTATCT | intron | N/A | ENSP00000624499.1 | |||||
| HSPD1 | TSL:5 | c.606+42_606+65dupTATGATCAAAAGTTTGAGTTATCT | intron | N/A | ENSP00000340019.2 | P10809-1 |
Frequencies
GnomAD3 genomes Cov.: 29
GnomAD4 exome Cov.: 8
GnomAD4 genome Cov.: 29
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at