NM_002249.6:c.212_241delAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant names:

• chr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT-G
• rs3831942
• NM_002249.6:c.212_241delAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_002249.6(KCNN3):​c.212_241delAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC​(p.Gln71_Gln80del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: not found (cov: 0)
  • Exomes 𝑓: 0.0000015 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: KCNN3 NM_002249.6 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 3.39
• Publications: 18 publications found

Genes affected

KCNN3 (HGNC:6292): (potassium calcium-activated channel subfamily N member 3) Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]

KCNN3 Gene-Disease associations (from GenCC):

• Zimmermann-Laband syndrome 3

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• Zimmermann-Laband syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• schizophrenia

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ENSG00000308854 (HGNC:):

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_002249.6

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_002249.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNN3	NM_002249.6	MANE Select	c.212_241delAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln71_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	NP_002240.3
	KCNN3	NM_001204087.2		c.212_241delAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln71_Gln80del	disruptive_inframe_deletion	Exon 1 of 9	NP_001191016.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNN3	ENST00000271915.9	TSL:1 MANE Select	c.212_241delAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln71_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	ENSP00000271915.3
	KCNN3	ENST00000618040.4	TSL:5	c.212_241delAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln71_Gln80del	disruptive_inframe_deletion	Exon 1 of 9	ENSP00000481848.1
	ENSG00000308854	ENST00000836873.1		n.195-646_195-617delCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG		intron	N/A

Frequencies

GnomAD3 genomes Cov.: 0

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000147 AC: 2 AN: 1365132 Hom.: 0 AF XY: 0.00000296 AC XY: 2 AN XY: 674890

African (AFR) AF: 0.00 AC: 0 AN: 31108

American (AMR) AF: 0.00 AC: 0 AN: 35514

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 24960

East Asian (EAS) AF: 0.00 AC: 0 AN: 35568

South Asian (SAS) AF: 0.00 AC: 0 AN: 78750

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 46140

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4434

European-Non Finnish (NFE) AF: 0.00000190 AC: 2 AN: 1051854

Other (OTH) AF: 0.00 AC: 0 AN: 56804

GnomAD4 genome Cov.: 0

Alfa AF: 0.00 Hom.: 292

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3831942; hg19: chr1-154842199;