NM_002691.4:c.501_524delGCTGAACTTGGCCATCAGCCGGGA
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_002691.4(POLD1):c.501_524delGCTGAACTTGGCCATCAGCCGGGA(p.Glu167_Arg174del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. E167E) has been classified as Likely benign.
Frequency
Consequence
NM_002691.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- POLD1-related polyposis and colorectal cancer syndromeInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- colorectal cancer, susceptibility to, 10Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, Genomics England PanelApp
- mandibular hypoplasia-deafness-progeroid syndromeInheritance: AD, AR Classification: STRONG, SUPPORTIVE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), PanelApp Australia, Genomics England PanelApp, Ambry Genetics, Orphanet, G2P
- Polymerase proofreading-related adenomatous polyposisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- immunodeficiency 120Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics
- non-severe combined immunodeficiency due to polymerase delta deficiencyInheritance: AR Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| POLD1 | NM_002691.4 | c.501_524delGCTGAACTTGGCCATCAGCCGGGA | p.Glu167_Arg174del | disruptive_inframe_deletion | Exon 5 of 27 | ENST00000440232.7 | NP_002682.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| POLD1 | ENST00000440232.7 | c.501_524delGCTGAACTTGGCCATCAGCCGGGA | p.Glu167_Arg174del | disruptive_inframe_deletion | Exon 5 of 27 | 1 | NM_002691.4 | ENSP00000406046.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Colorectal cancer, susceptibility to, 10 Uncertain:1
This sequence change deletes 24 nucleotides from exon 5 of the POLD1 mRNA (c.501_524del). This leads to the deletion of 8 amino acid residues in the POLD1 protein (p.Glu167_Arg174del) but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency) and has not been reported in the literature in individuals with a POLD1-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. In summary, this variant is a novel in-frame deletion with uncertain impact on protein function. It has been classified as a Variant of Uncertain Significance.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at