NM_002693.3:c.143_166delAGCAGCAGCAGCAGCAACAGCAGC

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_002693.3(POLG):​c.143_166delAGCAGCAGCAGCAGCAACAGCAGC​(p.Gln48_Gln55del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 30)

Consequence

POLG
NM_002693.3 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 2.58
Variant links:
Genes affected
POLG (HGNC:9179): (DNA polymerase gamma, catalytic subunit) Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
POLGARF (HGNC:56246): (POLG alternative reading frame) This gene uses the same transcript as the POLG gene but has a CUG start codon and an alternate reading frame that makes a 260 aa protein. This protein is distinct from POLG isoforms and may interact with P32 (also known as C1QBP), a mitochondrial matrix protein thought to be involved in the expression of mitochondrial genome-encoded proteins. POLGARF protein may bind P32 and sequester it in the nucleolus. Interestingly, some disease-causing mutations thought to be in POLG may instead be associated with POLGARF. [provided by RefSeq, May 2022]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 2 ACMG points.

PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
POLGNM_002693.3 linkc.143_166delAGCAGCAGCAGCAGCAACAGCAGC p.Gln48_Gln55del disruptive_inframe_deletion Exon 2 of 23 ENST00000268124.11 NP_002684.1 P54098E5KNU5
POLGNM_001126131.2 linkc.143_166delAGCAGCAGCAGCAGCAACAGCAGC p.Gln48_Gln55del disruptive_inframe_deletion Exon 2 of 23 NP_001119603.1 P54098E5KNU5
POLGARFNM_001430120.1 linkc.198_221delAGCAGCAGCAGCAGCAACAGCAGC p.Ala67_Ala74del disruptive_inframe_deletion Exon 1 of 2 NP_001417049.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
POLGENST00000268124.11 linkc.143_166delAGCAGCAGCAGCAGCAACAGCAGC p.Gln48_Gln55del disruptive_inframe_deletion Exon 2 of 23 1 NM_002693.3 ENSP00000268124.5 P54098
POLGARFENST00000706918.1 linkc.198_221delAGCAGCAGCAGCAGCAACAGCAGC p.Ala67_Ala74del disruptive_inframe_deletion Exon 1 of 2 ENSP00000516626.1 A0A3B3IS91

Frequencies

GnomAD3 genomes
Cov.:
30
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
30
Bravo
AF:
0.00000378

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Progressive sclerosing poliodystrophy Uncertain:1
Apr 16, 2022
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals affected with POLG-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.143_166del, results in the deletion of 8 amino acid(s) of the POLG protein (p.Gln48_Gln55del), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555454325; hg19: chr15-89876819; API