NM_003060.4:c.1267+3_1267+24delAGGGACCATGTGCATCTATGGT
Variant summary
Our verdict is Uncertain significance. Variant got 3 ACMG points: 3P and 0B. PM2PP3
The NM_003060.4(SLC22A5):c.1267+3_1267+24delAGGGACCATGTGCATCTATGGT variant causes a splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_003060.4 splice_region, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 3 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Renal carnitine transport defect Uncertain:2
This sequence change falls in intron 7 of the SLC22A5 gene. It does not directly change the encoded amino acid sequence of the SLC22A5 protein. It affects a nucleotide within the consensus splice site of the intron. This variant is not present in population databases (ExAC no frequency). This variant has been observed in individual(s) with clinical features of SLC22A5-related disease (PMID: 20574985). ClinVar contains an entry for this variant (Variation ID: 552220). Variants that disrupt the consensus splice site are a relatively common cause of aberrant splicing (PMID: 17576681, 9536098). Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at