NM_003070.5:c.681_707delGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chr9-2039776-ACAGCAGCAGCAGCAGCAGCAGCAGCAG-A
• rs113070757
• NM_003070.5:c.681_707delGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Likely benign. The variant received -5 ACMG points: 0P and 5B. BP3 BS2

The NM_003070.5(SMARCA2):​c.681_707delGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln228_Gln236del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000399 in 150,532 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. Q227Q) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.000040 (0 hom., cov: 26)
  • Exomes 𝑓: 0.000039 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: SMARCA2 NM_003070.5 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.94
• Publications: 9 publications found

Genes affected

SMARCA2 (HGNC:11098): (SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2) The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]

SMARCA2 Gene-Disease associations (from GenCC):

• intellectual disability-sparse hair-brachydactyly syndrome

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen

ACMG classification

Our verdict: Likely_benign. The variant received -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_003070.5
• BS2: High AC in GnomAd4 at 6 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003070.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SMARCA2	NM_003070.5	MANE Select	c.681_707delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln228_Gln236del	disruptive_inframe_deletion	Exon 4 of 34	NP_003061.3
	SMARCA2	NM_001289396.2		c.681_707delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln228_Gln236del	disruptive_inframe_deletion	Exon 4 of 34	NP_001276325.1
	SMARCA2	NM_139045.4		c.681_707delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln228_Gln236del	disruptive_inframe_deletion	Exon 4 of 33	NP_620614.2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SMARCA2	ENST00000349721.8	TSL:5 MANE Select	c.681_707delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln228_Gln236del	disruptive_inframe_deletion	Exon 4 of 34	ENSP00000265773.5
	SMARCA2	ENST00000382203.5	TSL:1	c.681_707delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln228_Gln236del	disruptive_inframe_deletion	Exon 4 of 34	ENSP00000371638.1
	SMARCA2	ENST00000450198.6	TSL:1	c.681_707delGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln228_Gln236del	disruptive_inframe_deletion	Exon 4 of 33	ENSP00000392081.2

Frequencies

GnomAD3 genomes AF: 0.0000399 AC: 6 AN: 150432 Hom.: 0 Cov.: 26

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000212

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000740

Gnomad OTH AF: 0.00

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000394 AC: 57 AN: 1445818 Hom.: 0 AF XY: 0.0000320 AC XY: 23 AN XY: 718570

African (AFR) AF: 0.0000610 AC: 2 AN: 32786

American (AMR) AF: 0.0000468 AC: 2 AN: 42718

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 25866

East Asian (EAS) AF: 0.00 AC: 0 AN: 38448

South Asian (SAS) AF: 0.0000236 AC: 2 AN: 84908

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 51680

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5568

European-Non Finnish (NFE) AF: 0.0000426 AC: 47 AN: 1104138

Other (OTH) AF: 0.0000670 AC: 4 AN: 59706

GnomAD4 genome AF: 0.0000399 AC: 6 AN: 150532 Hom.: 0 Cov.: 26 AF XY: 0.0000136 AC XY: 1 AN XY: 73486

African (AFR) AF: 0.00 AC: 0 AN: 40908

American (AMR) AF: 0.00 AC: 0 AN: 15128

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3462

East Asian (EAS) AF: 0.00 AC: 0 AN: 5082

South Asian (SAS) AF: 0.000212 AC: 1 AN: 4712

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10366

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 292

European-Non Finnish (NFE) AF: 0.0000740 AC: 5 AN: 67586

Other (OTH) AF: 0.00 AC: 0 AN: 2090

Alfa AF: 0.00 Hom.: 12

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.9
Mutation Taster		=170/30	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs113070757; hg19: chr9-2039776;