NM_003070.5:c.687_707delGCAGCAGCAGCAGCAGCAGCA
Variant summary
Our verdict is Benign. The variant received -10 ACMG points: 0P and 10B. BP3BP6BS1BS2
The NM_003070.5(SMARCA2):c.687_707delGCAGCAGCAGCAGCAGCAGCA(p.Gln230_Gln236del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000193 in 150,532 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_003070.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- intellectual disability-sparse hair-brachydactyly syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Benign. The variant received -10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_003070.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SMARCA2 | NM_003070.5 | MANE Select | c.687_707delGCAGCAGCAGCAGCAGCAGCA | p.Gln230_Gln236del | disruptive_inframe_deletion | Exon 4 of 34 | NP_003061.3 | ||
| SMARCA2 | NM_001289396.2 | c.687_707delGCAGCAGCAGCAGCAGCAGCA | p.Gln230_Gln236del | disruptive_inframe_deletion | Exon 4 of 34 | NP_001276325.1 | |||
| SMARCA2 | NM_139045.4 | c.687_707delGCAGCAGCAGCAGCAGCAGCA | p.Gln230_Gln236del | disruptive_inframe_deletion | Exon 4 of 33 | NP_620614.2 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SMARCA2 | ENST00000349721.8 | TSL:5 MANE Select | c.687_707delGCAGCAGCAGCAGCAGCAGCA | p.Gln230_Gln236del | disruptive_inframe_deletion | Exon 4 of 34 | ENSP00000265773.5 | ||
| SMARCA2 | ENST00000382203.5 | TSL:1 | c.687_707delGCAGCAGCAGCAGCAGCAGCA | p.Gln230_Gln236del | disruptive_inframe_deletion | Exon 4 of 34 | ENSP00000371638.1 | ||
| SMARCA2 | ENST00000450198.6 | TSL:1 | c.687_707delGCAGCAGCAGCAGCAGCAGCA | p.Gln230_Gln236del | disruptive_inframe_deletion | Exon 4 of 33 | ENSP00000392081.2 |
Frequencies
GnomAD3 genomes AF: 0.000193 AC: 29AN: 150432Hom.: 0 Cov.: 26 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000289 AC: 418AN: 1445818Hom.: 1 AF XY: 0.000266 AC XY: 191AN XY: 718570 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.000193 AC: 29AN: 150532Hom.: 0 Cov.: 26 AF XY: 0.000231 AC XY: 17AN XY: 73486 show subpopulations
Age Distribution
ClinVar
Submissions by phenotype
not provided Uncertain:1Benign:2
SMARCA2: BP3
See Variant Classification Assertion Criteria.
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals with SMARCA2-related conditions. This variant is not present in population databases (ExAC no frequency). This variant, c.687_707del, results in the deletion of 7 amino acid(s) of the SMARCA2 protein (p.Gln232_Gln238del), but otherwise preserves the integrity of the reading frame.
Inborn genetic diseases Benign:1
This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at