NM_003477.3:c.965_1023delATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PP3PP5

The NM_003477.3(PDHX):​c.965_1023delATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA variant causes a exon loss, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

Frequency

Genomes: not found (cov: 32)

Consequence

PDHX
NM_003477.3 exon_loss, splice_region

Scores

Not classified

Clinical Significance

Pathogenic no assertion criteria provided P:1

Conservation

PhyloP100: 8.38

Publications

0 publications found
Variant links:
Genes affected
PDHX (HGNC:21350): (pyruvate dehydrogenase complex component X) The pyruvate dehydrogenase (PDH) complex is located in the mitochondrial matrix and catalyzes the conversion of pyruvate to acetyl coenzyme A. The PDH complex thereby links glycolysis to Krebs cycle. The PDH complex contains three catalytic subunits, E1, E2, and E3, two regulatory subunits, E1 kinase and E1 phosphatase, and a non-catalytic subunit, E3 binding protein (E3BP). This gene encodes the E3 binding protein subunit; also known as component X of the pyruvate dehydrogenase complex. This protein tethers E3 dimers to the E2 core of the PDH complex. Defects in this gene are a cause of pyruvate dehydrogenase deficiency which results in neurological dysfunction and lactic acidosis in infancy and early childhood. This protein is also a minor antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC eventually leads to cirrhosis and liver failure. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]
PDHX Gene-Disease associations (from GenCC):
  • Leigh syndrome
    Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
  • pyruvate dehydrogenase E3-binding protein deficiency
    Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Genomics England PanelApp, Ambry Genetics, Labcorp Genetics (formerly Invitae)

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
PP5
Variant 11-34978123-GATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA-G is Pathogenic according to our data. Variant chr11-34978123-GATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA-G is described in ClinVar as Pathogenic. ClinVar VariationId is 2112.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
PDHXNM_003477.3 linkc.965_1023delATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA exon_loss_variant, splice_region_variant Exon 8 of 11 ENST00000227868.9 NP_003468.2 O00330-1
PDHXNM_001135024.2 linkc.785_843delATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA exon_loss_variant, splice_region_variant Exon 8 of 11 NP_001128496.2 O00330
PDHXXM_011520390.2 linkc.785_843delATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA exon_loss_variant, splice_region_variant Exon 8 of 11 XP_011518692.1 A0A8C8MSB2
PDHXNM_001166158.2 linkc.343-6446_343-6388delATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA intron_variant Intron 3 of 5 NP_001159630.1 O00330-2

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
PDHXENST00000227868.9 linkc.965-12_1011delATGACATTAAAGTATCAGTAAATGATTTTATCATCAAGGCAGCAGCTGTTACCCTTAAA p.Asp322fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 8 of 11 1 NM_003477.3 ENSP00000227868.4 O00330-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

Pyruvate dehydrogenase E3-binding protein deficiency Pathogenic:1
Dec 01, 1997
OMIM
Significance:Pathogenic
Review Status:no assertion criteria provided
Collection Method:literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
8.4
Mutation Taster
=1/199
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1554989996; hg19: chr11-34999670; API