NM_003482.4:c.2250_2276dupGCACCTGTCCCCCCGGCCTGAGGAGCC
Variant summary
Our verdict is Likely benign. The variant received -2 ACMG points: 2P and 4B. PM4BS2
The NM_003482.4(KMT2D):c.2250_2276dupGCACCTGTCCCCCCGGCCTGAGGAGCC(p.Pro759_His760insHisLeuSerProArgProGluGluPro) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000106 in 1,603,008 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. P759P) has been classified as Likely benign.
Frequency
Consequence
NM_003482.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- choanal atresia-athelia-hypothyroidism-delayed puberty-short stature syndromeInheritance: AD Classification: DEFINITIVE, MODERATE Submitted by: Illumina, G2P
- Kabuki syndrome 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics, Laboratory for Molecular Medicine, ClinGen
- branchial arch abnormalities, choanal atresia, athelia, hearing loss, and hypothyroidism syndromeInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- Kabuki syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_003482.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KMT2D | NM_003482.4 | MANE Select | c.2250_2276dupGCACCTGTCCCCCCGGCCTGAGGAGCC | p.Pro759_His760insHisLeuSerProArgProGluGluPro | disruptive_inframe_insertion | Exon 11 of 55 | NP_003473.3 | O14686-1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| KMT2D | ENST00000301067.12 | TSL:5 MANE Select | c.2250_2276dupGCACCTGTCCCCCCGGCCTGAGGAGCC | p.Pro759_His760insHisLeuSerProArgProGluGluPro | disruptive_inframe_insertion | Exon 11 of 55 | ENSP00000301067.7 | O14686-1 | |
| KMT2D | ENST00000683543.2 | c.2250_2276dupGCACCTGTCCCCCCGGCCTGAGGAGCC | p.Pro759_His760insHisLeuSerProArgProGluGluPro | disruptive_inframe_insertion | Exon 11 of 56 | ENSP00000506726.1 | A0A804HHR9 | ||
| KMT2D | ENST00000685166.1 | c.2250_2276dupGCACCTGTCCCCCCGGCCTGAGGAGCC | p.Pro759_His760insHisLeuSerProArgProGluGluPro | disruptive_inframe_insertion | Exon 10 of 54 | ENSP00000509386.1 | O14686-3 |
Frequencies
GnomAD3 genomes AF: 0.0000209 AC: 3AN: 143218Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000206 AC: 5AN: 242168 AF XY: 0.0000302 show subpopulations
GnomAD4 exome AF: 0.00000959 AC: 14AN: 1459790Hom.: 0 Cov.: 37 AF XY: 0.00000964 AC XY: 7AN XY: 726166 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000209 AC: 3AN: 143218Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 70096 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at