NM_003924.4:c.723_743delAGCAGCAGCGGCGGCGGCCGC
Variant summary
Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate
The NM_003924.4(PHOX2B):c.723_743delAGCAGCAGCGGCGGCGGCCGC(p.Ala242_Ala248del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000137 in 145,616 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★). Synonymous variant affecting the same amino acid position (i.e. A241A) has been classified as Likely benign.
Frequency
Consequence
NM_003924.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- central hypoventilation syndrome, congenital, 1, with or without Hirschsprung diseaseInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), ClinGen, G2P
- Haddad syndromeInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- neuroblastoma, susceptibility to, 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P
- congenital central hypoventilation syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -2 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
PHOX2B | ENST00000226382.4 | c.723_743delAGCAGCAGCGGCGGCGGCCGC | p.Ala242_Ala248del | disruptive_inframe_deletion | Exon 3 of 3 | 1 | NM_003924.4 | ENSP00000226382.2 | ||
PHOX2B | ENST00000510424.2 | n.*4_*24delAGCAGCAGCGGCGGCGGCCGC | downstream_gene_variant | 3 |
Frequencies
GnomAD3 genomes AF: 0.0000137 AC: 2AN: 145616Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.000902 AC: 5AN: 5542 AF XY: 0.00106 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000564 AC: 55AN: 975160Hom.: 0 AF XY: 0.0000648 AC XY: 30AN XY: 463118 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome AF: 0.0000137 AC: 2AN: 145616Hom.: 0 Cov.: 32 AF XY: 0.0000141 AC XY: 1AN XY: 70832 show subpopulations
ClinVar
Submissions by phenotype
Haddad syndrome Benign:1
- -
PHOX2B-related disorder Benign:1
This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at