NM_004006.3:c.1304_1331+10delGGGTAGCTAGCATGGAAAAACAAAGCAAGTAAGTCCTT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate

The NM_004006.3(DMD):​c.1304_1331+10delGGGTAGCTAGCATGGAAAAACAAAGCAAGTAAGTCCTT​(p.Arg435fs) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. R435R) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 22)

Consequence

DMD
NM_004006.3 frameshift, splice_donor, splice_region, intron

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 9.29

Publications

0 publications found
Variant links:
Genes affected
DMD (HGNC:2928): (dystrophin) This gene spans a genomic range of greater than 2 Mb and encodes a large protein containing an N-terminal actin-binding domain and multiple spectrin repeats. The encoded protein forms a component of the dystrophin-glycoprotein complex (DGC), which bridges the inner cytoskeleton and the extracellular matrix. Deletions, duplications, and point mutations at this gene locus may cause Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), or cardiomyopathy. Alternative promoter usage and alternative splicing result in numerous distinct transcript variants and protein isoforms for this gene. [provided by RefSeq, Dec 2016]
DMD Gene-Disease associations (from GenCC):
  • Becker muscular dystrophy
    Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet
  • dilated cardiomyopathy 3B
    Inheritance: XL Classification: DEFINITIVE Submitted by: Ambry Genetics
  • Duchenne and Becker muscular dystrophy
    Inheritance: XL Classification: DEFINITIVE Submitted by: Myriad Women’s Health
  • Duchenne muscular dystrophy
    Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P, Orphanet
  • progressive muscular dystrophy
    Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
  • familial isolated dilated cardiomyopathy
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • non-syndromic X-linked intellectual disability
    Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
  • symptomatic form of muscular dystrophy of Duchenne and Becker in female carriers
    Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 10 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant X-32644121-TAAGGACTTACTTGCTTTGTTTTTCCATGCTAGCTACCC-T is Pathogenic according to our data. Variant chrX-32644121-TAAGGACTTACTTGCTTTGTTTTTCCATGCTAGCTACCC-T is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 447250.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
DMDNM_004006.3 linkc.1304_1331+10delGGGTAGCTAGCATGGAAAAACAAAGCAAGTAAGTCCTT p.Arg435fs frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant Exon 11 of 79 ENST00000357033.9 NP_003997.2 P11532

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
DMDENST00000357033.9 linkc.1304_1331+10delGGGTAGCTAGCATGGAAAAACAAAGCAAGTAAGTCCTT p.Arg435fs frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant Exon 11 of 79 1 NM_004006.3 ENSP00000354923.3 A0A075B6G3

Frequencies

GnomAD3 genomes
Cov.:
22
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
22

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not provided Pathogenic:1
Jan 12, 2017
Athena Diagnostics
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1556875089; hg19: chrX-32662238; API