NM_004006.3:c.5613_5640delGGCTCTAGAAATTTCTCATCAGTGGTAT
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_004006.3(DMD):c.5613_5640delGGCTCTAGAAATTTCTCATCAGTGGTAT(p.Lys1871AsnfsTer11) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. K1871K) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_004006.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- Becker muscular dystrophyInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet
- dilated cardiomyopathy 3BInheritance: XL Classification: DEFINITIVE Submitted by: Ambry Genetics
- Duchenne and Becker muscular dystrophyInheritance: XL Classification: DEFINITIVE Submitted by: Myriad Women’s Health
- Duchenne muscular dystrophyInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P, Orphanet
- progressive muscular dystrophyInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- symptomatic form of muscular dystrophy of Duchenne and Becker in female carriersInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Transcripts
RefSeq
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| DMD | ENST00000357033.9 | c.5613_5640delGGCTCTAGAAATTTCTCATCAGTGGTAT | p.Lys1871AsnfsTer11 | frameshift_variant | Exon 40 of 79 | 1 | NM_004006.3 | ENSP00000354923.3 |
Frequencies
GnomAD3 genomes Cov.: 23
GnomAD4 genome Cov.: 23
ClinVar
Submissions by phenotype
Duchenne muscular dystrophy Pathogenic:1
This sequence change creates a premature translational stop signal (p.Lys1871Asnfs*11) in the DMD gene. It is expected to result in an absent or disrupted protein product. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with a DMD-related disease. Loss-of-function variants in DMD are known to be pathogenic (PMID: 16770791). For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at