NM_004316.4:c.160_186delCAGCAGCAGCAGCAGCAGCAGCAGCAG
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_004316.4(ASCL1):c.160_186delCAGCAGCAGCAGCAGCAGCAGCAGCAG(p.Gln54_Gln62del) variant causes a conservative inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000929 in 1,507,072 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_004316.4 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- phenylketonuriaInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen, Myriad Women’s Health
- classic phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- maternal phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- mild hyperphenylalaninemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- mild phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- tetrahydrobiopterin-responsive hyperphenylalaninemia/phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
ASCL1 | NM_004316.4 | c.160_186delCAGCAGCAGCAGCAGCAGCAGCAGCAG | p.Gln54_Gln62del | conservative_inframe_deletion | Exon 1 of 2 | ENST00000266744.4 | NP_004307.2 | |
PAH | n.102958420_102958394delTGCTGCTGCTGCTGCTGCTGCTGCTGC | bidirectional_gene_fusion | ||||||
PAH | NM_001354304.2 | c.-321_-295delTGCTGCTGCTGCTGCTGCTGCTGCTGC | 5_prime_UTR_variant | Exon 1 of 14 | NP_001341233.1 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.0000133 AC: 2AN: 150120Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome AF: 0.00000884 AC: 12AN: 1356952Hom.: 0 AF XY: 0.0000120 AC XY: 8AN XY: 669242 show subpopulations
GnomAD4 genome AF: 0.0000133 AC: 2AN: 150120Hom.: 0 Cov.: 0 AF XY: 0.0000137 AC XY: 1AN XY: 73222 show subpopulations
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at