NM_004343.4:c.1099_1150delCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGG
Variant summary
Our verdict is Likely pathogenic. Variant got 8 ACMG points: 12P and 4B. PVS1_StrongPP5_Very_StrongBS2
The NM_004343.4(CALR):c.1099_1150delCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGG(p.Leu367ThrfsTer46) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000301 in 1,460,220 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★).
Frequency
Consequence
NM_004343.4 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_pathogenic. Variant got 8 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.00 AC: 3AN: 152176Hom.: 0 Cov.: 31 FAILED QC
GnomAD4 exome AF: 0.0000301 AC: 44AN: 1460220Hom.: 0 AF XY: 0.0000441 AC XY: 32AN XY: 726272
GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000197 AC: 3AN: 152176Hom.: 0 Cov.: 31 AF XY: 0.0000269 AC XY: 2AN XY: 74348
ClinVar
Submissions by phenotype
Essential thrombocythemia Other:2
A large majority of myeloproliferative neoplasms with nonmutated JAK2 exhibit somatic CALR mutations. In a subset of such cases with essential thrombocythemia, 67% had CALR mutation. -
In a cohort of 1107 myeloproliferative neoplasm patients, those with "mutated CALR had a lower risk of thromobsis and longer overall survival than patients with mutated JAK2." -
Acute myeloid leukemia Other:2
While there are strong associations of this variant to thrombocythemia and myeloproliferative neoplasms, its oncogenicity and clinical impact in this case of acute myeloid leukemia is uncertain because the allele frequency decreased over time from 11% (progressive thrombocythemia) to 3% (AML in remission) to undetectable at AML relapse. -
While there are strong associations of this variant to thrombocythemia and myeloproliferative neoplasms, its oncogenicity and clinical impact in this case of acute myeloid leukemia is uncertain because the allele frequency decreased over time from 11% (progressive thrombocythemia) to 3% (AML in remission) to undetectable at AML relapse. -
not provided Pathogenic:1
CALR: PS4, PVS1:Strong, PM2:Supporting -
Thrombocythemia 1 Pathogenic:1
- -
Primary myelofibrosis Pathogenic:1
- -
Primary myelofibrosis;C3277671:Thrombocythemia 1 Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at