NM_004360.5:c.1553_1565+39delAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAACTGG

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong

The NM_004360.5(CDH1):​c.1553_1565+39delAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAACTGG​(p.Glu518ArgfsTer23) variant causes a frameshift, splice donor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. E518E) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

CDH1
NM_004360.5 frameshift, splice_donor, splice_region, intron

Scores

Not classified

Clinical Significance

Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:4

Conservation

PhyloP100: 8.95

Publications

1 publications found
Variant links:
Genes affected
CDH1 (HGNC:1748): (cadherin 1) This gene encodes a classical cadherin of the cadherin superfamily. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature glycoprotein. This calcium-dependent cell-cell adhesion protein is comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Mutations in this gene are correlated with gastric, breast, colorectal, thyroid and ovarian cancer. Loss of function of this gene is thought to contribute to cancer progression by increasing proliferation, invasion, and/or metastasis. The ectodomain of this protein mediates bacterial adhesion to mammalian cells and the cytoplasmic domain is required for internalization. This gene is present in a gene cluster with other members of the cadherin family on chromosome 16. [provided by RefSeq, Nov 2015]
CDH1 Gene-Disease associations (from GenCC):
  • blepharocheilodontic syndrome 1
    Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE Submitted by: Ambry Genetics, Illumina, Labcorp Genetics (formerly Invitae), G2P
  • CDH1-related diffuse gastric and lobular breast cancer syndrome
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, G2P
  • hereditary breast carcinoma
    Inheritance: AD Classification: DEFINITIVE Submitted by: Ambry Genetics
  • hereditary diffuse gastric adenocarcinoma
    Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet
  • cleft soft palate
    Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
  • orofacial cleft 3
    Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
  • blepharocheilodontic syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • familial ovarian cancer
    Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Pathogenic. The variant received 16 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 16-68815743-ATGGAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAAC-A is Pathogenic according to our data. Variant chr16-68815743-ATGGAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAAC-A is described in ClinVar as Pathogenic/Likely_pathogenic. ClinVar VariationId is 486829.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
CDH1NM_004360.5 linkc.1553_1565+39delAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAACTGG p.Glu518ArgfsTer23 frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant Exon 10 of 16 ENST00000261769.10 NP_004351.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
CDH1ENST00000261769.10 linkc.1550_1565+36delTGGAACAGAAAATAACGTAAGTGTGAGGATTTTTCAACTGACTTGCAGCAAC p.Met517ArgfsTer23 frameshift_variant, splice_donor_variant, splice_region_variant, intron_variant Exon 10 of 16 1 NM_004360.5 ENSP00000261769.4

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic/Likely pathogenic
Submissions summary: Pathogenic:4
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

not provided Pathogenic:2
May 13, 2019
GeneDx
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

Not observed in large population cohorts (Lek et al., 2016); Has not been previously published as pathogenic or benign to our knowledge

Nov 08, 2017
Quest Diagnostics Nichols Institute San Juan Capistrano
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

Hereditary cancer-predisposing syndrome Pathogenic:2
May 04, 2020
Color Diagnostics, LLC DBA Color Health
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant causes at a minimum the deletion of the last 13 nucleotides in exon 10 (r.1553_1565del) and the intron 10 splice donor site in the CDH1 gene. To our knowledge, functional and RNA studies have not been reported for this variant, nor has this variant been reported in individuals affected with hereditary cancer in the literature. Other variants that disrupted the canonical intron 10 splice donor site has been reported in individuals affected with breast and diffuse gastric cancer (PMID: 11968084, 18046629, 18788075, 24506336, 26182300, 26681312, 27064202, 27153395, and Lowstuter 2017 (https://ascopubs.org/doi/full/10.1200/PO.16.00021)). This variant has not been identified in the general population by the Genome Aggregation Database (gnomAD). Loss of CDH1 function is a known mechanism of disease. Based on the available evidence, this variant is classified as Likely Pathogenic.

Mar 02, 2018
Ambry Genetics
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The c.1553_1565+39del52 variant spans the 3' exon/intron boundary of coding exon 10 in the CDH1 gene. This variant results from a deletion of 52 nucleotides at positions c.1553 to c.1565+39. Using the BDGP and ESEfinder splice site prediction tools, this alteration is predicted to abolish the native splice donor site; however, direct evidence is unavailable. Alterations that disrupt the canonical splice site are expected to cause aberrant splicing, resulting in an abnormal protein or a transcript that is subject to nonsense-mediated mRNA decay. As such, this alteration is classified as likely pathogenic.

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
8.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555516191; hg19: chr16-68849646; API