NM_004655.4:c.1982_2008delATCTGTGGGGGGGCAACAGCGGGCACC
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_004655.4(AXIN2):c.1982_2008delATCTGTGGGGGGGCAACAGCGGGCACC(p.His661_His669del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★★). Synonymous variant affecting the same amino acid position (i.e. H661H) has been classified as Likely benign.
Frequency
Consequence
NM_004655.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- oligodontia-cancer predisposition syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, ClinGen, Orphanet, Labcorp Genetics (formerly Invitae)
- tooth agenesisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- craniosynostosisInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004655.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| AXIN2 | MANE Select | c.1982_2008delATCTGTGGGGGGGCAACAGCGGGCACC | p.His661_His669del | disruptive_inframe_deletion | Exon 8 of 11 | NP_004646.3 | Q9Y2T1 | ||
| AXIN2 | c.1787_1813delATCTGTGGGGGGGCAACAGCGGGCACC | p.His596_His604del | disruptive_inframe_deletion | Exon 7 of 10 | NP_001350742.1 | E7ES00 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| AXIN2 | TSL:1 MANE Select | c.1982_2008delATCTGTGGGGGGGCAACAGCGGGCACC | p.His661_His669del | disruptive_inframe_deletion | Exon 8 of 11 | ENSP00000302625.5 | Q9Y2T1 | ||
| AXIN2 | TSL:1 | c.1787_1813delATCTGTGGGGGGGCAACAGCGGGCACC | p.His596_His604del | disruptive_inframe_deletion | Exon 6 of 9 | ENSP00000364854.5 | E7ES00 | ||
| AXIN2 | c.1982_2008delATCTGTGGGGGGGCAACAGCGGGCACC | p.His661_His669del | disruptive_inframe_deletion | Exon 8 of 11 | ENSP00000551090.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at