NM_005228.5:c.2252_2277delCATCTCCGAAAGCCAACAAGGAAATCinsAA

Variant summary

Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1PM4PP3

The NM_005228.5(EGFR):​c.2252_2277delCATCTCCGAAAGCCAACAAGGAAATCinsAA​(p.Thr751_Ile759delinsLys) variant causes a missense, conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (no stars).

Frequency

Genomes: not found (cov: 33)

Consequence

EGFR
NM_005228.5 missense, conservative_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance no assertion criteria provided U:1

Conservation

PhyloP100: 9.22

Publications

0 publications found
Variant links:
Genes affected
EGFR (HGNC:3236): (epidermal growth factor receptor) The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor, thus inducing receptor dimerization and tyrosine autophosphorylation leading to cell proliferation. Mutations in this gene are associated with lung cancer. EGFR is a component of the cytokine storm which contributes to a severe form of Coronavirus Disease 2019 (COVID-19) resulting from infection with severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2). [provided by RefSeq, Jul 2020]
EGFR Gene-Disease associations (from GenCC):
  • lung cancer
    Inheritance: AD Classification: DEFINITIVE Submitted by: G2P, Ambry Genetics
  • non-small cell lung carcinoma
    Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
  • inflammatory skin and bowel disease, neonatal, 2
    Inheritance: AR Classification: STRONG, MODERATE, LIMITED Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
  • neonatal inflammatory skin and bowel disease
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 5 ACMG points.

PM1
In a hotspot region, there are 2 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 2 benign, 37 uncertain in NM_005228.5
PM4
Nonframeshift variant in NON repetitive region in NM_005228.5.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
EGFRNM_005228.5 linkc.2252_2277delCATCTCCGAAAGCCAACAAGGAAATCinsAA p.Thr751_Ile759delinsLys missense_variant, conservative_inframe_deletion ENST00000275493.7 NP_005219.2 P00533-1Q504U8F2YGG7

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
EGFRENST00000275493.7 linkc.2252_2277delCATCTCCGAAAGCCAACAAGGAAATCinsAA p.Thr751_Ile759delinsLys missense_variant, conservative_inframe_deletion 1 NM_005228.5 ENSP00000275493.2 P00533-1
EGFRENST00000455089.5 linkc.2117_2142delCATCTCCGAAAGCCAACAAGGAAATCinsAA p.Thr706_Ile714delinsLys missense_variant, conservative_inframe_deletion 1 ENSP00000415559.1 Q504U8
EGFRENST00000450046.2 linkc.2093_2118delCATCTCCGAAAGCCAACAAGGAAATCinsAA p.Thr698_Ile706delinsLys missense_variant, conservative_inframe_deletion 4 ENSP00000413354.2 C9JYS6
EGFRENST00000700145.1 linkc.599_624delCATCTCCGAAAGCCAACAAGGAAATCinsAA p.Thr200_Ile208delinsLys missense_variant, conservative_inframe_deletion ENSP00000514824.1 A0A8V8TPW8

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

not specified Uncertain:1
Jul 28, 2009
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Significance:Uncertain significance
Review Status:no assertion criteria provided
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
9.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs397517100; hg19: chr7-55242482; API