NM_005321.3:c.436_458delACCCCCAAGAAGAGCGCCAAGAA
Variant summary
Our verdict is Likely pathogenic. The variant received 6 ACMG points: 6P and 0B. PVS1_StrongPP5_Moderate
The NM_005321.3(H1-4):c.436_458delACCCCCAAGAAGAGCGCCAAGAA(p.Thr146AspfsTer42) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_005321.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- Rahman syndromeInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Illumina, Ambry Genetics, Labcorp Genetics (formerly Invitae), G2P
- syndromic intellectual disabilityInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 6 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005321.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| H1-4 | NM_005321.3 | MANE Select | c.436_458delACCCCCAAGAAGAGCGCCAAGAA | p.Thr146AspfsTer42 | frameshift | Exon 1 of 1 | NP_005312.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| H1-4 | ENST00000304218.6 | TSL:6 MANE Select | c.436_458delACCCCCAAGAAGAGCGCCAAGAA | p.Thr146AspfsTer42 | frameshift | Exon 1 of 1 | ENSP00000307705.4 | ||
| ENSG00000291336 | ENST00000707189.1 | n.999+32655_999+32677delACCCCCAAGAAGAGCGCCAAGAA | intron | N/A |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at