NM_005343.4:c.186_206dupGGAGTACAGCGCCATGCGGGA
Variant summary
Our verdict is Likely pathogenic. Variant got 8 ACMG points: 8P and 0B. PM1PM2PM4PP5_Moderate
The NM_005343.4(HRAS):c.186_206dupGGAGTACAGCGCCATGCGGGA(p.Glu62_Arg68dup) variant causes a disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_005343.4 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_pathogenic. Variant got 8 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
HRAS | NM_005343.4 | c.186_206dupGGAGTACAGCGCCATGCGGGA | p.Glu62_Arg68dup | disruptive_inframe_insertion | Exon 3 of 6 | ENST00000311189.8 | NP_005334.1 | |
HRAS | NM_176795.5 | c.186_206dupGGAGTACAGCGCCATGCGGGA | p.Glu62_Arg68dup | disruptive_inframe_insertion | Exon 3 of 6 | ENST00000417302.7 | NP_789765.1 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
HRAS | ENST00000311189.8 | c.186_206dupGGAGTACAGCGCCATGCGGGA | p.Glu62_Arg68dup | disruptive_inframe_insertion | Exon 3 of 6 | 1 | NM_005343.4 | ENSP00000309845.7 | ||
HRAS | ENST00000417302.7 | c.186_206dupGGAGTACAGCGCCATGCGGGA | p.Glu62_Arg68dup | disruptive_inframe_insertion | Exon 3 of 6 | 5 | NM_176795.5 | ENSP00000388246.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome Cov.: 34
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Costello syndrome Pathogenic:1
This variant, c.186_206dup, results in the insertion of 7 amino acid(s) of the HRAS protein (p.Glu62_Arg68dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with clinical features of RASopathy (PMID: 32499600, 34618388; Invitae). In at least one individual the variant was observed to be de novo. ClinVar contains an entry for this variant (Variation ID: 462149). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects HRAS function (PMID: 32499600, 34618388). For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at