NM_005529.7:c.7210_7233delGAGTACGTGTGCCGAGTGTTGGGC

Variant names:

• chr1-21850422-CTGCCCAACACTCGGCACACGTACT-CT
• NM_005529.7:c.7211_7233delAGTACGTGTGCCGAGTGTTGGGC

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The NM_005529.7(HSPG2):​c.7211_7233delAGTACGTGTGCCGAGTGTTGGGC​(p.Tyr2405LeufsTer13) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 33)
• Consequence: HSPG2 NM_005529.7 frameshift
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.46
• Publications: 0 publications found

Genes affected

HSPG2 (HGNC:5273): (heparan sulfate proteoglycan 2) This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and transthyretin, etc., and it plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and tardive dyskinesia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]

HSPG2 Gene-Disease associations (from GenCC):

• Schwartz-Jampel syndrome type 1

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen
• Silverman-Handmaker type dyssegmental dysplasia

  Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, ClinGen, Labcorp Genetics (formerly Invitae), G2P
• Schwartz-Jampel syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005529.7. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HSPG2	NM_005529.7	MANE Select	c.7211_7233delAGTACGTGTGCCGAGTGTTGGGC	p.Tyr2405LeufsTer13	frameshift	Exon 56 of 97	NP_005520.4
	HSPG2	NM_001291860.2		c.7214_7236delAGTACGTGTGCCGAGTGTTGGGC	p.Tyr2406LeufsTer13	frameshift	Exon 56 of 97	NP_001278789.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	HSPG2	ENST00000374695.8	TSL:1 MANE Select	c.7211_7233delAGTACGTGTGCCGAGTGTTGGGC	p.Tyr2405LeufsTer13	frameshift	Exon 56 of 97	ENSP00000363827.3	P98160

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.5

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

hg19: chr1-22176915;