NM_006231.4:c.3858_3881delCCTCGCCCGCAGGAAGAGGCAGCG
Variant summary
Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM4
The NM_006231.4(POLE):c.3858_3881delCCTCGCCCGCAGGAAGAGGCAGCG(p.Leu1287_Arg1294del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.00000479 in 1,460,678 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Uncertain significance (★★).
Frequency
Consequence
NM_006231.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 2 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome AF: 0.00000479 AC: 7AN: 1460678Hom.: 0 AF XY: 0.00000275 AC XY: 2AN XY: 726658
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
not provided Uncertain:2
This variant, c.3858_3881del, results in the deletion of 8 amino acid(s) of the POLE protein (p.Ala1288_Leu1295del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs759449495, gnomAD 0.0009%). This variant has not been reported in the literature in individuals affected with POLE-related conditions. ClinVar contains an entry for this variant (Variation ID: 422681). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
In-frame deletion of 8 amino acids in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; Not observed at significant frequency in large population cohorts (gnomAD); Has not been previously published as pathogenic or benign to our knowledge; This variant is associated with the following publications: (PMID: 37250013) -
not specified Uncertain:1
- -
Hereditary cancer-predisposing syndrome Uncertain:1
The c.3858_3881del24 variant (also known as p.A1288_L1295del) is located in coding exon 31 of the POLE gene. This variant results from an in-frame deletion of 24 nucleotides at positions 1288 to 1295. This results in the deletion of 8 amino acids between codons 3858 and 3881. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at