NM_006306.4:c.3056_3082delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG

Variant summary

Our verdict is Pathogenic. Variant got 13 ACMG points: 13P and 0B. PVS1PM2PP2PP5_Moderate

The NM_006306.4(SMC1A):​c.3056_3082delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG​(p.Arg1019LeufsTer186) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 22)

Consequence

SMC1A
NM_006306.4 frameshift, missense

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, single submitter P:1O:1

Conservation

PhyloP100: 9.23
Variant links:
Genes affected
SMC1A (HGNC:11111): (structural maintenance of chromosomes 1A) Proper cohesion of sister chromatids is a prerequisite for the correct segregation of chromosomes during cell division. The cohesin multiprotein complex is required for sister chromatid cohesion. This complex is composed partly of two structural maintenance of chromosomes (SMC) proteins, SMC3 and either SMC1B or the protein encoded by this gene. Most of the cohesin complexes dissociate from the chromosomes before mitosis, although those complexes at the kinetochore remain. Therefore, the encoded protein is thought to be an important part of functional kinetochores. In addition, this protein interacts with BRCA1 and is phosphorylated by ATM, indicating a potential role for this protein in DNA repair. This gene, which belongs to the SMC gene family, is located in an area of the X-chromosome that escapes X inactivation. Mutations in this gene result in Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 13 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP2
Missense variant in the SMC1A gene, where missense mutations are typically associated with disease (based on misZ statistic). The gene has 68 curated pathogenic missense variants (we use a threshold of 10). The gene has 31 curated benign missense variants. Gene score misZ: 6.4479 (above the threshold of 3.09). GenCC associations: The gene is linked to Cornelia de Lange syndrome, X-linked complex neurodevelopmental disorder, atypical Rett syndrome, Cornelia de Lange syndrome 2, developmental and epileptic encephalopathy, 85, with or without midline brain defects.
PP5
Variant X-53383145-TGGCCTTCATGTTGGGGGCGGCAATAC-CTGCA is Pathogenic according to our data. Variant chrX-53383145-TGGCCTTCATGTTGGGGGCGGCAATAC-CTGCA is described in ClinVar as [Likely_pathogenic]. Clinvar id is 532571.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
SMC1ANM_006306.4 linkc.3056_3082delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG p.Arg1019LeufsTer186 frameshift_variant, missense_variant Exon 20 of 25 ENST00000322213.9 NP_006297.2 Q14683A0A384MR33Q68EN4
SMC1ANM_001281463.1 linkc.2990_3016delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG p.Arg997LeufsTer186 frameshift_variant, missense_variant Exon 21 of 26 NP_001268392.1 G8JLG1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
SMC1AENST00000322213.9 linkc.3056_3082delGTATTGCCGCCCCCAACATGAAGGCCAinsTGCAG p.Arg1019LeufsTer186 frameshift_variant, missense_variant Exon 20 of 25 1 NM_006306.4 ENSP00000323421.3 Q14683

Frequencies

GnomAD3 genomes
Cov.:
22
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
22

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:1Other:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Congenital muscular hypertrophy-cerebral syndrome Pathogenic:1Other:1
-
GenomeConnect - Invitae Patient Insights Network
Significance: not provided
Review Status: no classification provided
Collection Method: phenotyping only

Variant interpreted as Likely pathogenic and reported on 12-27-2017 by Invitae. GenomeConnect-Invitae Patient Insights Network assertions are reported exactly as they appear on the patient-provided report from the testing laboratory. Registry team members make no attempt to reinterpret the clinical significance of the variant. Phenotypic details are available under supporting information. -

Dec 13, 2017
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Likely pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

In summary, the currently available evidence indicates that the variant is pathogenic, but additional data are needed to prove that conclusively. Therefore, this variant has been classified as Likely Pathogenic. A different variant present in the disrupted region (p.Tyr1085Cys) has been determined to be likely pathogenic (PMID: 17221863, Invitae). This suggests that the tyrosine residue is critical for SMC1A protein function and that other variants disrupting this position may also be pathogenic. This variant has not been reported in the literature in individuals with SMC1A-related disease. This variant is not present in population databases (ExAC no frequency). This sequence change results in a premature translational stop signal in the SMC1A gene (p.Arg1019Leufs*186). While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt 185 amino acids and delete the last 30 amino acids of the SMC1A protein. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1556886127; hg19: chrX-53410066; API