NM_006393.3:c.2923_2980delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_006393.3(NEBL):​c.2923_2980delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG​(p.Phe975AlafsTer38) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

NEBL
NM_006393.3 frameshift

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 9.32
Variant links:
Genes affected
NEBL (HGNC:16932): (nebulette) This gene encodes a nebulin like protein that is abundantly expressed in cardiac muscle. The encoded protein binds actin and interacts with thin filaments and Z-line associated proteins in striated muscle. This protein may be involved in cardiac myofibril assembly. A shorter isoform of this protein termed LIM nebulette is expressed in non-muscle cells and may function as a component of focal adhesion complexes. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 2 ACMG points.

PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
NEBLNM_006393.3 linkc.2923_2980delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG p.Phe975AlafsTer38 frameshift_variant Exon 28 of 28 ENST00000377122.9 NP_006384.1 O76041-1Q59FZ8

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
NEBLENST00000377122.9 linkc.2923_2980delTTTAGAGACGGCGACTACATCGTCAACGTGCAGCCTATTGACGATGGCTGGATGTACG p.Phe975AlafsTer38 frameshift_variant Exon 28 of 28 1 NM_006393.3 ENSP00000366326.4 O76041-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Primary dilated cardiomyopathy Uncertain:1
Dec 16, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Phe975Alafs*38) in the NEBL gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 40 amino acid(s) of the NEBL protein. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with NEBL-related conditions. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr10-21074740; API