NM_007294.4:c.3172_3192dupATTAATGAAATAGGTTCCAGT
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_007294.4(BRCA1):c.3172_3192dupATTAATGAAATAGGTTCCAGT(p.Ser1064_Asp1065insIleAsnGluIleGlySerSer) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. S1064S) has been classified as Likely benign. The gene BRCA1 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_007294.4 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- BRCA1-related cancer predispositionInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- breast-ovarian cancer, familial, susceptibility to, 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
- Fanconi anemia, complementation group SInheritance: AR Classification: DEFINITIVE, STRONG, MODERATE, LIMITED Submitted by: G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen
- pancreatic cancer, susceptibility to, 4Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
- hereditary breast ovarian cancer syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Fanconi anemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_007294.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BRCA1 | MANE Select | c.3172_3192dupATTAATGAAATAGGTTCCAGT | p.Ser1064_Asp1065insIleAsnGluIleGlySerSer | conservative_inframe_insertion | Exon 10 of 23 | NP_009225.1 | P38398-1 | ||
| BRCA1 | c.3172_3192dupATTAATGAAATAGGTTCCAGT | p.Ser1064_Asp1065insIleAsnGluIleGlySerSer | conservative_inframe_insertion | Exon 10 of 24 | NP_001394510.1 | A0A2R8Y7V5 | |||
| BRCA1 | c.3172_3192dupATTAATGAAATAGGTTCCAGT | p.Ser1064_Asp1065insIleAsnGluIleGlySerSer | conservative_inframe_insertion | Exon 10 of 24 | NP_001394511.1 | A0A2R8Y7V5 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BRCA1 | TSL:1 MANE Select | c.3172_3192dupATTAATGAAATAGGTTCCAGT | p.Ser1064_Asp1065insIleAsnGluIleGlySerSer | conservative_inframe_insertion | Exon 10 of 23 | ENSP00000350283.3 | P38398-1 | ||
| BRCA1 | TSL:1 | c.3172_3192dupATTAATGAAATAGGTTCCAGT | p.Ser1064_Asp1065insIleAsnGluIleGlySerSer | conservative_inframe_insertion | Exon 10 of 24 | ENSP00000418960.2 | P38398-7 | ||
| BRCA1 | TSL:1 | c.3172_3192dupATTAATGAAATAGGTTCCAGT | p.Ser1064_Asp1065insIleAsnGluIleGlySerSer | conservative_inframe_insertion | Exon 10 of 23 | ENSP00000419274.2 | P38398-1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 exome Cov.: 38
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.