NM_007294.4:c.3172_3192dupATTAATGAAATAGGTTCCAGT

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_007294.4(BRCA1):​c.3172_3192dupATTAATGAAATAGGTTCCAGT​(p.Ser1064_Asp1065insIleAsnGluIleGlySerSer) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. S1064S) has been classified as Likely benign.

Frequency

Genomes: not found (cov: 32)

Consequence

BRCA1
NM_007294.4 conservative_inframe_insertion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 1.21

Publications

1 publications found
Variant links:
Genes affected
BRCA1 (HGNC:1100): (BRCA1 DNA repair associated) This gene encodes a 190 kD nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The BRCA1 gene contains 22 exons spanning about 110 kb of DNA. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2020]
BRCA1 Gene-Disease associations (from GenCC):
  • breast-ovarian cancer, familial, susceptibility to, 1
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
  • Fanconi anemia, complementation group S
    Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE, LIMITED Submitted by: G2P, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
  • pancreatic cancer, susceptibility to, 4
    Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
  • hereditary breast ovarian cancer syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • Fanconi anemia
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_007294.4.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
BRCA1NM_007294.4 linkc.3172_3192dupATTAATGAAATAGGTTCCAGT p.Ser1064_Asp1065insIleAsnGluIleGlySerSer conservative_inframe_insertion Exon 10 of 23 ENST00000357654.9 NP_009225.1 P38398-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
BRCA1ENST00000357654.9 linkc.3172_3192dupATTAATGAAATAGGTTCCAGT p.Ser1064_Asp1065insIleAsnGluIleGlySerSer conservative_inframe_insertion Exon 10 of 23 1 NM_007294.4 ENSP00000350283.3 P38398-1

Frequencies

GnomAD3 genomes
Cov.:
32
GnomAD4 exome
Cov.:
38
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Hereditary breast ovarian cancer syndrome Uncertain:1
Dec 05, 2017
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant, c.3172_3192dup, results in the insertion of 7 amino acids to the BRCA1 protein (p.Ile1058_Ser1064dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with BRCA1-related disease. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the duplicated amino acids is currently unknown. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site, but this prediction has not been confirmed by published transcriptional studies. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
1.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555588237; hg19: chr17-41244355; API