NM_007294.4:c.594-56_594-19delAGTTCTGCATACATGTAACTAGTGTTTCTTATTAGGAC

Variant summary

Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate

The NM_007294.4(BRCA1):​c.594-56_594-19delAGTTCTGCATACATGTAACTAGTGTTTCTTATTAGGAC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).

Frequency

Genomes: not found (cov: 31)

Consequence

BRCA1
NM_007294.4 intron

Scores

Not classified

Clinical Significance

Likely benign criteria provided, single submitter B:1

Conservation

PhyloP100: 2.23

Publications

0 publications found
Variant links:
Genes affected
BRCA1 (HGNC:1100): (BRCA1 DNA repair associated) This gene encodes a 190 kD nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The BRCA1 gene contains 22 exons spanning about 110 kb of DNA. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2020]
BRCA1 Gene-Disease associations (from GenCC):
  • breast-ovarian cancer, familial, susceptibility to, 1
    Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
  • Fanconi anemia, complementation group S
    Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE, LIMITED Submitted by: G2P, Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
  • pancreatic cancer, susceptibility to, 4
    Inheritance: AD Classification: MODERATE Submitted by: Genomics England PanelApp
  • hereditary breast ovarian cancer syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • Fanconi anemia
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Likely_benign. The variant received -2 ACMG points.

BP6
Variant 17-43095940-AGTCCTAATAAGAAACACTAGTTACATGTATGCAGAACT-A is Benign according to our data. Variant chr17-43095940-AGTCCTAATAAGAAACACTAGTTACATGTATGCAGAACT-A is described in ClinVar as Likely_benign. ClinVar VariationId is 531490.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
BRCA1NM_007294.4 linkc.594-56_594-19delAGTTCTGCATACATGTAACTAGTGTTTCTTATTAGGAC intron_variant Intron 8 of 22 ENST00000357654.9 NP_009225.1 P38398-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
BRCA1ENST00000357654.9 linkc.594-56_594-19delAGTTCTGCATACATGTAACTAGTGTTTCTTATTAGGAC intron_variant Intron 8 of 22 1 NM_007294.4 ENSP00000350283.3 P38398-1

Frequencies

GnomAD3 genomes
Cov.:
31
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
31

ClinVar

Significance: Likely benign
Submissions summary: Benign:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Hereditary breast ovarian cancer syndrome Benign:1
Aug 27, 2021
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Likely benign
Review Status:criteria provided, single submitter
Collection Method:clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
2.2

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555593640; hg19: chr17-41247957; API