Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_007294.4(BRCA1):c.952_1015delCATAACAGATGGGCTGGAAGTAAGGAAACATGTAATGATAGGCGGACTCCCAGCACAGAAAAAA(p.His318ArgfsTer2) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★★). Variant results in nonsense mediated mRNA decay.
BRCA1 (HGNC:1100): (BRCA1 DNA repair associated) This gene encodes a 190 kD nuclear phosphoprotein that plays a role in maintaining genomic stability, and it also acts as a tumor suppressor. The BRCA1 gene contains 22 exons spanning about 110 kb of DNA. The encoded protein combines with other tumor suppressors, DNA damage sensors, and signal transducers to form a large multi-subunit protein complex known as the BRCA1-associated genome surveillance complex (BASC). This gene product associates with RNA polymerase II, and through the C-terminal domain, also interacts with histone deacetylase complexes. This protein thus plays a role in transcription, DNA repair of double-stranded breaks, and recombination. Mutations in this gene are responsible for approximately 40% of inherited breast cancers and more than 80% of inherited breast and ovarian cancers. Alternative splicing plays a role in modulating the subcellular localization and physiological function of this gene. Many alternatively spliced transcript variants, some of which are disease-associated mutations, have been described for this gene, but the full-length natures of only some of these variants has been described. A related pseudogene, which is also located on chromosome 17, has been identified. [provided by RefSeq, May 2020]
BRCA1 Gene-Disease associations (from GenCC):
breast-ovarian cancer, familial, susceptibility to, 1
Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, ClinGen, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
Our verdict: Pathogenic. The variant received 16 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 17-43094515-TTTTTTTCTGTGCTGGGAGTCCGCCTATCATTACATGTTTCCTTACTTCCAGCCCATCTGTTATG-T is Pathogenic according to our data. Variant chr17-43094515-TTTTTTTCTGTGCTGGGAGTCCGCCTATCATTACATGTTTCCTTACTTCCAGCCCATCTGTTATG-T is described in ClinVar as Pathogenic. ClinVar VariationId is 37710.Status of the report is reviewed_by_expert_panel, 3 stars.
The c.952_1015del64 pathogenic mutation, located in coding exon 9 of the BRCA1 gene, results from a deletion of 64 nucleotides at nucleotide positions 952 to 1015, causing a translational frameshift with a predicted alternate stop codon (p.H318Rfs*2). One study detected this mutation in 1/100 triple-negative breast cancer patients from Germany and Austria (Muendlein A et al. J. Cancer Res. Clin. Oncol., 2015 Nov;141:2005-12). This alteration was also identified in a large, worldwide study of BRCA1/2 mutation positive families (Rebbeck TR et al. Hum. Mutat., 2018 May;39:593-620). This variant is considered to be rare based on population cohorts in the Genome Aggregation Database (gnomAD). In addition to the clinical data presented in the literature, this alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -
Hereditary breast ovarian cancer syndromePathogenic:1
Mar 25, 2024
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing
This sequence change creates a premature translational stop signal (p.His318Argfs*2) in the BRCA1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BRCA1 are known to be pathogenic (PMID: 20104584). This variant is not present in population databases (gnomAD no frequency). This premature translational stop signal has been observed in individual(s) with breast cancer (PMID: 25971625). This variant is also known as c.952_1015del64 and 1071del64. ClinVar contains an entry for this variant (Variation ID: 37710). For these reasons, this variant has been classified as Pathogenic. -