NM_013236.4:c.1174-11559_1174-11535delATTCTATTCTATTCTATTCTATTCT

Variant names:

• chr22-45795354-GATTCTATTCTATTCTATTCTATTCT-G
• rs60726084
• NM_013236.4:c.1174-11559_1174-11535delATTCTATTCTATTCTATTCTATTCT

Variant summary

Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2

The NM_013236.4(ATXN10):​c.1174-11559_1174-11535delATTCTATTCTATTCTATTCTATTCT variant causes a intron change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.00081 (1 hom., cov: 0)
• Consequence: ATXN10 NM_013236.4 intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.237
• Publications: 1 publications found

Genes affected

ATXN10 (HGNC:10549): (ataxin 10) This gene encodes a protein that may function in neuron survival, neuron differentiation, and neuritogenesis. These roles may be carried out via activation of the mitogen-activated protein kinase cascade. Expansion of an ATTCT repeat from 9-32 copies to 800-4500 copies in an intronic region of this locus has been associated with spinocerebellar ataxia, type 10. Alternatively spliced transcript variants have been described.[provided by RefSeq, Jul 2016]

ATXN10 Gene-Disease associations (from GenCC):

• spinocerebellar ataxia type 10

  Inheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_benign. The variant received -4 ACMG points.

• BS2: High AC in GnomAd4 at 103 AD gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_013236.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATXN10	NM_013236.4	MANE Select	c.1174-11559_1174-11535delATTCTATTCTATTCTATTCTATTCT		intron	N/A	NP_037368.1
	ATXN10	NM_001167621.2		c.982-11559_982-11535delATTCTATTCTATTCTATTCTATTCT		intron	N/A	NP_001161093.1

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ATXN10	ENST00000252934.10	TSL:1 MANE Select	c.1174-11604_1174-11580delATTCTATTCTATTCTATTCTATTCT		intron	N/A	ENSP00000252934.4
	ATXN10	ENST00000381061.8	TSL:2	c.982-11604_982-11580delATTCTATTCTATTCTATTCTATTCT		intron	N/A	ENSP00000370449.4
	ATXN10	ENST00000435026.5	TSL:3	c.430-11604_430-11580delATTCTATTCTATTCTATTCTATTCT		intron	N/A	ENSP00000391117.1

Frequencies

GnomAD3 genomes AF: 0.000751 AC: 95 AN: 126538 Hom.: 1 Cov.: 0

Gnomad AFR AF: 0.00123

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000324

Gnomad ASJ AF: 0.00358

Gnomad EAS AF: 0.00223

Gnomad SAS AF: 0.00359

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.000269

Gnomad OTH AF: 0.000588

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome AF: 0.000813 AC: 103 AN: 126644 Hom.: 1 Cov.: 0 AF XY: 0.000888 AC XY: 54 AN XY: 60838

African (AFR) AF: 0.00147 AC: 49 AN: 33336

American (AMR) AF: 0.000324 AC: 4 AN: 12350

Ashkenazi Jewish (ASJ) AF: 0.00358 AC: 11 AN: 3076

East Asian (EAS) AF: 0.00223 AC: 9 AN: 4032

South Asian (SAS) AF: 0.00358 AC: 13 AN: 3630

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 7936

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 272

European-Non Finnish (NFE) AF: 0.000269 AC: 16 AN: 59482

Other (OTH) AF: 0.000583 AC: 1 AN: 1714

Alfa AF: 0.00 Hom.: 99

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.24

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs60726084; hg19: chr22-46191234;