NM_014946.4:c.1322-30_1322-2delATTAAAGTCTTATACTTGTATTTCCTCTA
Variant summary
Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5
The NM_014946.4(SPAST):c.1322-30_1322-2delATTAAAGTCTTATACTTGTATTTCCTCTA variant causes a splice acceptor, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_014946.4 splice_acceptor, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- hereditary spastic paraplegia 4Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Illumina, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), PanelApp Australia, Ambry Genetics, Orphanet
- Charlevoix-Saguenay spastic ataxiaInheritance: AR Classification: DEFINITIVE Submitted by: G2P
- neurodevelopmental disorderInheritance: AD Classification: STRONG Submitted by: G2P
- SPAST-related motor disorderInheritance: AR Classification: STRONG Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 9 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_014946.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SPAST | MANE Select | c.1322-30_1322-2delATTAAAGTCTTATACTTGTATTTCCTCTA | splice_acceptor splice_region intron | N/A | NP_055761.2 | ||||
| SPAST | c.1319-30_1319-2delATTAAAGTCTTATACTTGTATTTCCTCTA | splice_acceptor splice_region intron | N/A | NP_001350752.1 | A0A2U3TZR0 | ||||
| SPAST | c.1226-30_1226-2delATTAAAGTCTTATACTTGTATTTCCTCTA | splice_acceptor splice_region intron | N/A | NP_955468.1 | E5KRP6 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SPAST | TSL:1 MANE Select | c.1322-32_1322-4delTAATTAAAGTCTTATACTTGTATTTCCTC | splice_region intron | N/A | ENSP00000320885.3 | Q9UBP0-1 | |||
| SPAST | TSL:1 | c.1319-32_1319-4delTAATTAAAGTCTTATACTTGTATTTCCTC | splice_region intron | N/A | ENSP00000482496.2 | A0A2U3TZR0 | |||
| SPAST | c.1427-32_1427-4delTAATTAAAGTCTTATACTTGTATTTCCTC | splice_region intron | N/A | ENSP00000519019.1 | A0AAQ5BGQ0 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.