NM_015238.3:c.2280+33_2280+60delGCTGGCTGGCTGGCTGGCTGGCTGGCTG
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_015238.3(WWC1):c.2280+33_2280+60delGCTGGCTGGCTGGCTGGCTGGCTGGCTG variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000395 in 1,266,092 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_015238.3 intron
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.00 AC: 0AN: 148354Hom.: 0 Cov.: 0
GnomAD4 exome AF: 0.00000395 AC: 5AN: 1266092Hom.: 0 AF XY: 0.00000318 AC XY: 2AN XY: 628358 show subpopulations
Age Distribution
GnomAD4 genome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0AN: 148354Hom.: 0 Cov.: 0 AF XY: 0.00 AC XY: 0AN XY: 72076
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at