NM_015570.4:c.1594_1623delCAGCACACCCACCAGCACACGCACCAGCAC
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 3P and 1B. PM1PP3BP3
The NM_015570.4(AUTS2):c.1594_1623delCAGCACACCCACCAGCACACGCACCAGCAC(p.Gln532_His541del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_015570.4 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- autism spectrum disorder due to AUTS2 deficiencyInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, G2P
- syndromic intellectual disabilityInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_015570.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| AUTS2 | MANE Select | c.1594_1623delCAGCACACCCACCAGCACACGCACCAGCAC | p.Gln532_His541del | conservative_inframe_deletion | Exon 9 of 19 | NP_056385.1 | Q8WXX7-1 | ||
| AUTS2 | c.1594_1623delCAGCACACCCACCAGCACACGCACCAGCAC | p.Gln532_His541del | conservative_inframe_deletion | Exon 9 of 18 | NP_001120703.1 | Q8WXX7-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| AUTS2 | TSL:1 MANE Select | c.1594_1623delCAGCACACCCACCAGCACACGCACCAGCAC | p.Gln532_His541del | conservative_inframe_deletion | Exon 9 of 19 | ENSP00000344087.4 | Q8WXX7-1 | ||
| AUTS2 | TSL:1 | c.1594_1623delCAGCACACCCACCAGCACACGCACCAGCAC | p.Gln532_His541del | conservative_inframe_deletion | Exon 9 of 18 | ENSP00000385263.2 | Q8WXX7-2 | ||
| AUTS2 | c.1591_1620delCAGCACACCCACCAGCACACGCACCAGCAC | p.Gln531_His540del | conservative_inframe_deletion | Exon 9 of 19 | ENSP00000496726.1 | A0A2R8Y8C6 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at