NM_017780.4:c.2614-25_2614-4delACTTTTTTTTTTCCCTTTGGTG
Variant summary
Our verdict is Likely benign. The variant received -2 ACMG points: 0P and 2B. BP6_Moderate
The NM_017780.4(CHD7):c.2614-25_2614-4delACTTTTTTTTTTCCCTTTGGTG variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely benign (★).
Frequency
Consequence
NM_017780.4 splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- CHARGE syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Broad Center for Mendelian Genomics, Labcorp Genetics (formerly Invitae), PanelApp Australia, ClinGen, G2P, Orphanet
- hypogonadotropic hypogonadism 5 with or without anosmiaInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- hypogonadotropic hypogonadismInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Kallmann syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Omenn syndromeInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -2 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_017780.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CHD7 | NM_017780.4 | MANE Select | c.2614-25_2614-4delACTTTTTTTTTTCCCTTTGGTG | splice_region intron | N/A | NP_060250.2 | |||
| CHD7 | NM_001316690.1 | c.1716+38932_1716+38953delACTTTTTTTTTTCCCTTTGGTG | intron | N/A | NP_001303619.1 | Q9P2D1-4 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| CHD7 | ENST00000423902.7 | TSL:5 MANE Select | c.2614-25_2614-4delACTTTTTTTTTTCCCTTTGGTG | splice_region intron | N/A | ENSP00000392028.1 | Q9P2D1-1 | ||
| CHD7 | ENST00000524602.5 | TSL:1 | c.1716+38932_1716+38953delACTTTTTTTTTTCCCTTTGGTG | intron | N/A | ENSP00000437061.1 | Q9P2D1-4 | ||
| CHD7 | ENST00000933299.1 | c.2614-25_2614-4delACTTTTTTTTTTCCCTTTGGTG | splice_region intron | N/A | ENSP00000603358.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at