NM_020433.5:c.493_514delTCCCTGCGCAGCGAGCACAGCAinsC
Variant summary
Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PM1PM2PM4PP3
The NM_020433.5(JPH2):c.493_514delTCCCTGCGCAGCGAGCACAGCAinsC(p.Ser165_Asn172delinsHis) variant causes a missense, conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_020433.5 missense, conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_pathogenic. Variant got 7 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Hypertrophic cardiomyopathy Uncertain:1
In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the disrupted amino acids is currently unknown. This variant has not been reported in the literature in individuals with JPH2-related disease. While this variant is not present in population databases, the frequency information is unreliable, as metrics indicate poor data quality at this position in the ExAC database. This sequence change deletes 22 nucleotides and inserts 1 nucleotide in exon 2 of the JPH2 mRNA (c.493_514delinsC). This leads to the replacement of 8 amino acids by an histidine residue in the JPH2 protein (p.Ser165_Asn172delinsHis), but otherwise preserves the integrity of the reading frame. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at