NM_020433.5:c.493_514delTCCCTGCGCAGCGAGCACAGCAinsC

Variant summary

Our verdict is Likely pathogenic. Variant got 7 ACMG points: 7P and 0B. PM1PM2PM4PP3

The NM_020433.5(JPH2):​c.493_514delTCCCTGCGCAGCGAGCACAGCAinsC​(p.Ser165_Asn172delinsHis) variant causes a missense, conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 32)

Consequence

JPH2
NM_020433.5 missense, conservative_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 9.29
Variant links:
Genes affected
JPH2 (HGNC:14202): (junctophilin 2) Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. This gene is a member of the junctophilin gene family. Alternative splicing has been observed at this locus and two variants encoding distinct isoforms are described. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Likely_pathogenic. Variant got 7 ACMG points.

PM1
In a compositionally_biased_region Polar residues (size 15) in uniprot entity JPH2_HUMAN there are 4 pathogenic changes around while only 0 benign (100%) in NM_020433.5
PM2
Very rare variant in population databases, with high coverage;
PM4
Nonframeshift variant in NON repetitive region in NM_020433.5.
PP3
No computational evidence supports a deleterious effect, but strongly conserved according to phyloP

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
JPH2NM_020433.5 linkc.493_514delTCCCTGCGCAGCGAGCACAGCAinsC p.Ser165_Asn172delinsHis missense_variant, conservative_inframe_deletion Exon 2 of 6 ENST00000372980.4 NP_065166.2 Q9BR39-1Q86VZ3

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
JPH2ENST00000372980.4 linkc.493_514delTCCCTGCGCAGCGAGCACAGCAinsC p.Ser165_Asn172delinsHis missense_variant, conservative_inframe_deletion Exon 2 of 6 5 NM_020433.5 ENSP00000362071.3 Q9BR39-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Hypertrophic cardiomyopathy Uncertain:1
Apr 15, 2018
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the disrupted amino acids is currently unknown. This variant has not been reported in the literature in individuals with JPH2-related disease. While this variant is not present in population databases, the frequency information is unreliable, as metrics indicate poor data quality at this position in the ExAC database. This sequence change deletes 22 nucleotides and inserts 1 nucleotide in exon 2 of the JPH2 mRNA (c.493_514delinsC). This leads to the replacement of 8 amino acids by an histidine residue in the JPH2 protein (p.Ser165_Asn172delinsHis), but otherwise preserves the integrity of the reading frame. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555858801; hg19: chr20-42788913; API