NM_020975.6:c.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC
Variant summary
Our verdict is Uncertain significance. The variant received 5 ACMG points: 5P and 0B. PM1PM4PP3
The NM_020975.6(RET):c.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC(p.Phe612_Cys620del) variant causes a conservative inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. F612F) has been classified as Likely benign.
Frequency
Consequence
NM_020975.6 conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- familial medullary thyroid carcinomaInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, G2P
- multiple endocrine neoplasia type 2AInheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen, G2P
- multiple endocrine neoplasia type 2BInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae), ClinGen
- pheochromocytomaInheritance: AD Classification: DEFINITIVE Submitted by: G2P
- Hirschsprung disease, susceptibility to, 1Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
- Haddad syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Hirschsprung diseaseInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- renal agenesis, unilateralInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- bilateral renal agenesisInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- renal agenesisInheritance: AR Classification: LIMITED Submitted by: G2P
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 5 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_020975.6. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RET | NM_020975.6 | MANE Select | c.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC | p.Phe612_Cys620del | conservative_inframe_deletion | Exon 10 of 20 | NP_066124.1 | ||
| RET | NM_001406743.1 | c.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC | p.Phe612_Cys620del | conservative_inframe_deletion | Exon 10 of 21 | NP_001393672.1 | |||
| RET | NM_001406744.1 | c.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC | p.Phe612_Cys620del | conservative_inframe_deletion | Exon 10 of 20 | NP_001393673.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| RET | ENST00000355710.8 | TSL:5 MANE Select | c.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC | p.Phe612_Cys620del | conservative_inframe_deletion | Exon 10 of 20 | ENSP00000347942.3 | ||
| RET | ENST00000340058.6 | TSL:1 | c.1834_1860delTTCCCTGAGGAGGAGAAGTGCTTCTGC | p.Phe612_Cys620del | conservative_inframe_deletion | Exon 10 of 19 | ENSP00000344798.4 | ||
| RET | ENST00000713926.1 | c.1705_1731delTTCCCTGAGGAGGAGAAGTGCTTCTGC | p.Phe569_Cys577del | conservative_inframe_deletion | Exon 10 of 19 | ENSP00000519223.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at