NM_024298.5:c.758_778delAGTGCGGCTGCATTGCCGCCG
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PM4PP5_Very_Strong
The NM_024298.5(MBOAT7):c.758_778delAGTGCGGCTGCATTGCCGCCG(p.Glu253_Ala259del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000525 in 1,579,556 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).
Frequency
Consequence
NM_024298.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- complex neurodevelopmental disorderInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- intellectual disability, autosomal recessive 57Inheritance: AR Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
- autosomal recessive non-syndromic intellectual disabilityInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_024298.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MBOAT7 | MANE Select | c.758_778delAGTGCGGCTGCATTGCCGCCG | p.Glu253_Ala259del | disruptive_inframe_deletion | Exon 6 of 8 | NP_077274.3 | |||
| MBOAT7 | c.539_559delAGTGCGGCTGCATTGCCGCCG | p.Glu180_Ala186del | disruptive_inframe_deletion | Exon 4 of 6 | NP_001139528.1 | Q96N66-2 | |||
| MBOAT7 | c.539_559delAGTGCGGCTGCATTGCCGCCG | p.Glu180_Ala186del | disruptive_inframe_deletion | Exon 5 of 7 | NP_001139555.1 | Q96N66-2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MBOAT7 | TSL:1 MANE Select | c.758_778delAGTGCGGCTGCATTGCCGCCG | p.Glu253_Ala259del | disruptive_inframe_deletion | Exon 6 of 8 | ENSP00000245615.1 | Q96N66-1 | ||
| MBOAT7 | TSL:1 | c.539_559delAGTGCGGCTGCATTGCCGCCG | p.Glu180_Ala186del | disruptive_inframe_deletion | Exon 5 of 7 | ENSP00000410503.2 | Q96N66-2 | ||
| MBOAT7 | TSL:1 | c.758_778delAGTGCGGCTGCATTGCCGCCG | p.Glu253_Ala259del | disruptive_inframe_deletion | Exon 6 of 7 | ENSP00000375634.1 | Q96N66-3 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152202Hom.: 0 Cov.: 31 show subpopulations
GnomAD2 exomes AF: 0.0000219 AC: 4AN: 182932 AF XY: 0.0000301 show subpopulations
GnomAD4 exome AF: 0.0000574 AC: 82AN: 1427354Hom.: 0 AF XY: 0.0000622 AC XY: 44AN XY: 707032 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152202Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0AN XY: 74356 show subpopulations
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at