NM_033159.4:c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG

Variant names:

• chr3-50302170-GCACATACATCTGTGACTTCCCTGTGCCCTCCAGCAC-CGGGCCACACGGAA
• rs1553713075
• NM_033159.4:c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG

Variant summary

Our verdict is Pathogenic. Variant got 11 ACMG points: 11P and 0B. PVS1 PM2 PP5

The NM_033159.4(HYAL1):​c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG​(p.Val251PhefsTer20) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (no stars). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: HYAL1 NM_033159.4 frameshift, missense
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 8.82

Genes affected

HYAL1 (HGNC:5320): (hyaluronidase 1) This gene encodes a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 11 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 3-50302170-GCACATACATCTGTGACTTCCCTGTGCCCTCCAGCAC-CGGGCCACACGGAA is Pathogenic according to our data. Variant chr3-50302170-GCACATACATCTGTGACTTCCCTGTGCCCTCCAGCAC-CGGGCCACACGGAA is described in ClinVar as [Pathogenic]. Clinvar id is 3531.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HYAL1	NM_033159.4	c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG	p.Val251PhefsTer20	frameshift_variant, missense_variant	Exon 2 of 4	ENST00000395144.7	NP_149349.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HYAL1	ENST00000395144.7	c.751_787delGTGCTGGAGGGCACAGGGAAGTCACAGATGTATGTGCinsTTCCGTGTGGCCCG	p.Val251PhefsTer20	frameshift_variant, missense_variant	Exon 2 of 4	1	NM_033159.4	ENSP00000378576.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: no assertion criteria provided

Submissions by phenotype

Deficiency of hyaluronoglucosaminidase Pathogenic:1

May 25, 1999

OMIM

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1553713075; hg19: chr3-50339601;