NM_080680.3:c.2822_2848delAGAGAGGTCACCCAGGCCCCCCGGGGC
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4PP3PP5
The NM_080680.3(COL11A2):c.2822_2848delAGAGAGGTCACCCAGGCCCCCCGGGGC(p.Glu941_Pro950delinsAla) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).
Frequency
Consequence
NM_080680.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- autosomal dominant nonsyndromic hearing loss 13Inheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, LIMITED Submitted by: Ambry Genetics, PanelApp Australia, Labcorp Genetics (formerly Invitae), G2P
- nonsyndromic genetic hearing lossInheritance: AD, AR Classification: DEFINITIVE, MODERATE Submitted by: ClinGen
- otospondylomegaepiphyseal dysplasia, autosomal dominantInheritance: AD Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: PanelApp Australia, Ambry Genetics, Orphanet, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), G2P
- autosomal recessive nonsyndromic hearing loss 53Inheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: G2P, PanelApp Australia, Ambry Genetics, Labcorp Genetics (formerly Invitae)
- otospondylomegaepiphyseal dysplasiaInheritance: AR, AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
- otospondylomegaepiphyseal dysplasia, autosomal recessiveInheritance: AR Classification: DEFINITIVE, STRONG, MODERATE Submitted by: PanelApp Australia, Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
- autosomal dominant nonsyndromic hearing lossInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- fibrochondrogenesisInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- hearing loss, autosomal recessiveInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| COL11A2 | NM_080680.3 | c.2822_2848delAGAGAGGTCACCCAGGCCCCCCGGGGC | p.Glu941_Pro950delinsAla | disruptive_inframe_deletion | Exon 39 of 66 | ENST00000341947.7 | NP_542411.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| COL11A2 | ENST00000341947.7 | c.2822_2848delAGAGAGGTCACCCAGGCCCCCCGGGGC | p.Glu941_Pro950delinsAla | disruptive_inframe_deletion | Exon 39 of 66 | 5 | NM_080680.3 | ENSP00000339915.2 | ||
| COL11A2 | ENST00000374708.8 | c.2564_2590delAGAGAGGTCACCCAGGCCCCCCGGGGC | p.Glu855_Pro864delinsAla | disruptive_inframe_deletion | Exon 37 of 64 | 5 | ENSP00000363840.4 | |||
| COL11A2 | ENST00000477772.1 | n.272+4403_272+4429delAGAGAGGTCACCCAGGCCCCCCGGGGC | intron_variant | Intron 5 of 8 | 2 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 genome Cov.: 31
ClinVar
Submissions by phenotype
Otospondylomegaepiphyseal dysplasia, autosomal dominant Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at