NM_139058.3:c.426_458dupAGGGGCCGCCGCGGCAGCCGCGGCCGCGGCCGC

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4PP5_Moderate

The NM_139058.3(ARX):​c.426_458dupAGGGGCCGCCGCGGCAGCCGCGGCCGCGGCCGC​(p.Ala153_Ala154insGlyAlaAlaAlaAlaAlaAlaAlaAlaAlaAla) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000142 in 706,679 control chromosomes in the GnomAD database, with no homozygous occurrence. There are no hemizygote samples in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 22)
Exomes 𝑓: 0.0000014 ( 0 hom. 0 hem. )

Consequence

ARX
NM_139058.3 disruptive_inframe_insertion

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 1.53

Publications

1 publications found
Variant links:
Genes affected
ARX (HGNC:18060): (aristaless related homeobox) This gene is a homeobox-containing gene expressed during development. The expressed protein contains two conserved domains, a C-peptide (or aristaless domain) and the prd-like class homeobox domain. It is a member of the group-II aristaless-related protein family whose members are expressed primarily in the central and/or peripheral nervous system. This gene is thought to be involved in CNS development. Expansion of a polyalanine tract and other mutations in this gene cause X-linked cognitive disability and epilepsy. [provided by RefSeq, Jul 2016]
ARX Gene-Disease associations (from GenCC):
  • genetic developmental and epileptic encephalopathy
    Inheritance: XL, AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
  • intellectual disability, X-linked, with or without seizures, ARX-related
    Inheritance: XL Classification: DEFINITIVE, MODERATE Submitted by: Ambry Genetics, G2P
  • Partington syndrome
    Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
  • X-linked complex neurodevelopmental disorder
    Inheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
  • X-linked lissencephaly with abnormal genitalia
    Inheritance: XL Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
  • infantile spasms
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • corpus callosum agenesis-abnormal genitalia syndrome
    Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
  • infantile epileptic-dyskinetic encephalopathy
    Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
  • non-syndromic X-linked intellectual disability
    Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
  • X-linked spasticity-intellectual disability-epilepsy syndrome
    Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_139058.3.
PP5
Variant X-25013536-G-GGCGGCCGCGGCCGCGGCTGCCGCGGCGGCCCCT is Pathogenic according to our data. Variant chrX-25013536-G-GGCGGCCGCGGCCGCGGCTGCCGCGGCGGCCCCT is described in ClinVar as Pathogenic. ClinVar VariationId is 473011.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
ARXNM_139058.3 linkc.426_458dupAGGGGCCGCCGCGGCAGCCGCGGCCGCGGCCGC p.Ala153_Ala154insGlyAlaAlaAlaAlaAlaAlaAlaAlaAlaAla disruptive_inframe_insertion Exon 2 of 5 ENST00000379044.5 NP_620689.1 Q96QS3

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
ARXENST00000379044.5 linkc.426_458dupAGGGGCCGCCGCGGCAGCCGCGGCCGCGGCCGC p.Ala153_Ala154insGlyAlaAlaAlaAlaAlaAlaAlaAlaAlaAla disruptive_inframe_insertion Exon 2 of 5 1 NM_139058.3 ENSP00000368332.4 Q96QS3

Frequencies

GnomAD3 genomes
Cov.:
22
GnomAD4 exome
AF:
0.00000142
AC:
1
AN:
706679
Hom.:
0
Cov.:
31
AF XY:
0.00
AC XY:
0
AN XY:
214469
show subpopulations
African (AFR)
AF:
0.00
AC:
0
AN:
13636
American (AMR)
AF:
0.00
AC:
0
AN:
2499
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
5778
East Asian (EAS)
AF:
0.00
AC:
0
AN:
6383
South Asian (SAS)
AF:
0.00
AC:
0
AN:
15719
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
6042
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
1372
European-Non Finnish (NFE)
AF:
0.00000159
AC:
1
AN:
630488
Other (OTH)
AF:
0.00
AC:
0
AN:
24762
Allele Balance Distribution
Red line indicates average allele balance
Average allele balance: 0.475
Heterozygous variant carriers
0
0
1
1
2
2
0.00
0.20
0.40
0.60
0.80
0.95
Allele balance

Age Distribution

Exome Het
Variant carriers
0
2
4
6
8
10
<30
30-35
35-40
40-45
45-50
50-55
55-60
60-65
65-70
70-75
75-80
>80
Age
GnomAD4 genome
Cov.:
22

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Intellectual disability, X-linked, with or without seizures, ARX-related;C3463992:Developmental and epileptic encephalopathy, 1 Pathogenic:1
Oct 13, 2022
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

This variant, c.426_458dup, results in the insertion of 11 amino acid(s) of the ARX protein (p.Gly143_Ala153dup), but otherwise preserves the integrity of the reading frame. For these reasons, this variant has been classified as Pathogenic. This variant results in expansion of a poly-alanine tract in ARX. Expansions of the alanine tracts in ARX have been observed in individuals with ARX-related conditions (PMID: 11889467, 17664401, 23246292). ClinVar contains an entry for this variant (Variation ID: 473011). This variant is also known as c.423_455dup33, c.424_453dup, and dup33. This variant has been observed in individual(s) with X-linked intellectual disability and neurological disorders (PMID: 19507262). It has also been observed to segregate with disease in related individuals. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate insufficient coverage at this position in the gnomAD database. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
1.5
Mutation Taster
=66/34
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1556056154; hg19: chrX-25031653; API