NM_139058.3:c.702_764delAGAAGATGAGGACGAGGAAGAGGAACTGCTGGAGGACGACGAGGAGGAGCTGCTGGAGGACGA
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_139058.3(ARX):c.702_764delAGAAGATGAGGACGAGGAAGAGGAACTGCTGGAGGACGACGAGGAGGAGCTGCTGGAGGACGA(p.Glu234_Asp254del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_139058.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- genetic developmental and epileptic encephalopathyInheritance: XL, AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: ClinGen, Orphanet
- intellectual disability, X-linked, with or without seizures, ARX-relatedInheritance: XL Classification: DEFINITIVE, MODERATE Submitted by: Ambry Genetics, G2P
- Partington syndromeInheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
- X-linked complex neurodevelopmental disorderInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- X-linked lissencephaly with abnormal genitaliaInheritance: XL Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
- infantile spasmsInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- corpus callosum agenesis-abnormal genitalia syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- infantile epileptic-dyskinetic encephalopathyInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- non-syndromic X-linked intellectual disabilityInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
- X-linked spasticity-intellectual disability-epilepsy syndromeInheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| ARX | NM_139058.3 | c.702_764delAGAAGATGAGGACGAGGAAGAGGAACTGCTGGAGGACGACGAGGAGGAGCTGCTGGAGGACGA | p.Glu234_Asp254del | disruptive_inframe_deletion | Exon 2 of 5 | ENST00000379044.5 | NP_620689.1 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| ARX | ENST00000379044.5 | c.702_764delAGAAGATGAGGACGAGGAAGAGGAACTGCTGGAGGACGACGAGGAGGAGCTGCTGGAGGACGA | p.Glu234_Asp254del | disruptive_inframe_deletion | Exon 2 of 5 | 1 | NM_139058.3 | ENSP00000368332.4 |
Frequencies
GnomAD3 genomes Cov.: 23
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.00000191 AC: 2AN: 1046681Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 336661 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Cov.: 23
ClinVar
Submissions by phenotype
Intellectual disability, X-linked, with or without seizures, ARX-related;C3463992:Developmental and epileptic encephalopathy, 1 Uncertain:1
This variant, c.702_764del, results in the deletion of 21 amino acid(s) of the ARX protein (p.Glu234_Asp254del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has not been reported in the literature in individuals affected with ARX-related conditions. ClinVar contains an entry for this variant (Variation ID: 540221). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at