NM_147127.5:c.3870_3893dupGAAAAAGAAGAACTTTTTGAATGC
Variant summary
Our verdict is Uncertain significance. Variant got 4 ACMG points: 4P and 0B. PM2PM4
The NM_147127.5(EVC2):c.3870_3893dupGAAAAAGAAGAACTTTTTGAATGC(p.Ala1298_Lys1299insLysLysLysAsnPheLeuAsnAla) variant causes a disruptive inframe insertion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_147127.5 disruptive_inframe_insertion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 4 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome Cov.: 32
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Meckel-Gruber syndrome Pathogenic:1
- -
not specified Uncertain:1
Variant summary: EVC2 c.3870_3893dup24 (p.Lys1293_Lys1300dup) results in an in-frame duplication that is predicted to duplicate 8 amino acids into the encoded protein. The variant was absent in 251424 control chromosomes. The available data on variant occurrences in the general population are insufficient to allow any conclusion about variant significance. c.3870_3893dup24 has been reported in the literature in at least one homozygous individual affected with Meckel-Gruber syndrome (Shaheen_2013). These report(s) do not provide unequivocal conclusions about association of the variant with Ellis-van Creveld syndrome. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. The following publications have been ascertained in the context of this evaluation (PMID: 29620724, 23169490, 34645488). ClinVar contains an entry for this variant (Variation ID: 183329). Based on the evidence outlined above, the variant was classified as uncertain significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at