NM_152383.5:c.491_514delTCATTGTAGAGGCTCAGTTTGATG
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_152383.5(DIS3L2):c.491_514delTCATTGTAGAGGCTCAGTTTGATG(p.Val164_Asp171del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000000684 in 1,461,780 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_152383.5 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- Perlman syndromeInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Orphanet, Labcorp Genetics (formerly Invitae), G2P
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| DIS3L2 | NM_152383.5 | c.491_514delTCATTGTAGAGGCTCAGTTTGATG | p.Val164_Asp171del | disruptive_inframe_deletion | Exon 6 of 21 | ENST00000325385.12 | NP_689596.4 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| DIS3L2 | ENST00000325385.12 | c.491_514delTCATTGTAGAGGCTCAGTTTGATG | p.Val164_Asp171del | disruptive_inframe_deletion | Exon 6 of 21 | 5 | NM_152383.5 | ENSP00000315569.7 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 exome AF: 6.84e-7 AC: 1AN: 1461780Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 727188 show subpopulations
GnomAD4 genome Cov.: 31
ClinVar
Submissions by phenotype
Perlman syndrome Uncertain:1
ClinVar contains an entry for this variant (Variation ID: 531927). In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. This variant has not been reported in the literature in individuals affected with DIS3L2-related conditions. This variant is not present in population databases (gnomAD no frequency). This variant, c.491_514del, results in the deletion of 8 amino acid(s) of the DIS3L2 protein (p.Val164_Asp171del), but otherwise preserves the integrity of the reading frame. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at