NM_152743.4:c.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_152743.4(BRAT1):c.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC(p.Glu515SerfsTer15) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_152743.4 frameshift, missense
Scores
Clinical Significance
Conservation
Publications
- neonatal-onset encephalopathy with rigidity and seizuresInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Ambry Genetics, Orphanet, ClinGen, G2P, Labcorp Genetics (formerly Invitae)
- neurodevelopmental disorder with cerebellar atrophy and with or without seizuresInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen, Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_152743.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BRAT1 | NM_152743.4 | MANE Select | c.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC | p.Glu515SerfsTer15 | frameshift missense | Exon 12 of 14 | NP_689956.2 | ||
| BRAT1 | NM_001350626.2 | c.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC | p.Glu515SerfsTer15 | frameshift missense | Exon 12 of 14 | NP_001337555.1 | |||
| BRAT1 | NM_001350627.2 | c.1018_1039delGAGGTGAGGGACTCCGCCCTCGinsTC | p.Glu340SerfsTer15 | frameshift missense | Exon 11 of 13 | NP_001337556.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| BRAT1 | ENST00000340611.9 | TSL:1 MANE Select | c.1543_1564delGAGGTGAGGGACTCCGCCCTCGinsTC | p.Glu515SerfsTer15 | frameshift missense | Exon 12 of 14 | ENSP00000339637.4 | ||
| BRAT1 | ENST00000467558.5 | TSL:5 | n.2915_2936delGAGGTGAGGGACTCCGCCCTCGinsTC | non_coding_transcript_exon | Exon 9 of 10 | ||||
| BRAT1 | ENST00000469750.5 | TSL:2 | n.4115_4136delGAGGTGAGGGACTCCGCCCTCGinsTC | non_coding_transcript_exon | Exon 9 of 11 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
Neonatal-onset encephalopathy with rigidity and seizures Pathogenic:1
This sequence change creates a premature translational stop signal (p.Glu515Serfs*15) in the BRAT1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in BRAT1 are known to be pathogenic (PMID: 22279524, 25500575). Information on the frequency of this variant in the gnomAD database is not available, as this variant may be reported differently in the database. This variant has not been reported in the literature in individuals affected with BRAT1-related conditions. For these reasons, this variant has been classified as Pathogenic.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at