NM_174878.3:c.188_210delACGGGCTTTTCCACGGAGAGGGT

Variant summary

Our verdict is Likely pathogenic. The variant received 9 ACMG points: 9P and 0B. PVS1PP5

The NM_174878.3(CLRN1):​c.188_210delACGGGCTTTTCCACGGAGAGGGT​(p.Tyr63CysfsTer59) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars). Synonymous variant affecting the same amino acid position (i.e. Y63Y) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

CLRN1
NM_174878.3 frameshift

Scores

Not classified

Clinical Significance

Pathogenic no assertion criteria provided P:2

Conservation

PhyloP100: 7.42

Publications

1 publications found
Variant links:
Genes affected
CLRN1 (HGNC:12605): (clarin 1) This gene encodes a protein that contains a cytosolic N-terminus, multiple helical transmembrane domains, and an endoplasmic reticulum membrane retention signal, TKGH, in the C-terminus. The encoded protein may be important in development and homeostasis of the inner ear and retina. Mutations within this gene have been associated with Usher syndrome type IIIa. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
SIAH2-AS1 (HGNC:40526): (SIAH2 antisense RNA 1)
CLRN1-AS1 (HGNC:30895): (CLRN1 antisense RNA 1)

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Likely_pathogenic. The variant received 9 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PP5
Variant 3-150972498-CACCCTCTCCGTGGAAAAGCCCGT-C is Pathogenic according to our data. Variant chr3-150972498-CACCCTCTCCGTGGAAAAGCCCGT-C is described in ClinVar as Pathogenic. ClinVar VariationId is 4398.Status of the report is no_assertion_criteria_provided, 0 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
CLRN1NM_174878.3 linkc.188_210delACGGGCTTTTCCACGGAGAGGGT p.Tyr63CysfsTer59 frameshift_variant Exon 1 of 3 ENST00000327047.6 NP_777367.1 P58418-3

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
CLRN1ENST00000327047.6 linkc.188_210delACGGGCTTTTCCACGGAGAGGGT p.Tyr63CysfsTer59 frameshift_variant Exon 1 of 3 1 NM_174878.3 ENSP00000322280.1 P58418-3

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: no assertion criteria provided
LINK: link

Submissions by phenotype

Usher syndrome type 3 Pathogenic:2
May 15, 2025
Natera, Inc.
Significance:Pathogenic
Review Status:no assertion criteria provided
Collection Method:clinical testing

- -

Jun 01, 2002
OMIM
Significance:Pathogenic
Review Status:no assertion criteria provided
Collection Method:literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
7.4
Mutation Taster
=2/198
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1553776036; hg19: chr3-150690285; API