NM_176806.4:c.-8_15delTAGGCGGGATGGTGCCGCTGTGC

Variant summary

Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1PS1_ModeratePM2PP5_Moderate

The NM_176806.4(MOCS2):​c.-8_15delTAGGCGGGATGGTGCCGCTGTGC​(p.Met1fs) variant causes a frameshift, start lost change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

Frequency

Genomes: not found (cov: 33)

Consequence

MOCS2
NM_176806.4 frameshift, start_lost

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, single submitter P:2

Conservation

PhyloP100: 3.20
Variant links:
Genes affected
MOCS2 (HGNC:7193): (molybdenum cofactor synthesis 2) Eukaryotic molybdoenzymes use a unique molybdenum cofactor (MoCo) consisting of a pterin, termed molybdopterin, and the catalytically active metal molybdenum. MoCo is synthesized from precursor Z by the heterodimeric enzyme molybdopterin synthase. The large and small subunits of molybdopterin synthase are both encoded from this gene by overlapping open reading frames. The proteins were initially thought to be encoded from a bicistronic transcript. They are now thought to be encoded from monocistronic transcripts. Alternatively spliced transcripts have been found for this locus that encode the large and small subunits. [provided by RefSeq, Jul 2008]
MOCS2-DT (HGNC:27417): (MOCS2 divergent transcript)

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 14 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 24 pathogenic variants in the truncated region.
PS1
Another start lost variant in NM_176806.4 (MOCS2) was described as [Likely_pathogenic] in ClinVar as 813890
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 5-53109714-GGCACAGCGGCACCATCCCGCCTA-G is Pathogenic according to our data. Variant chr5-53109714-GGCACAGCGGCACCATCCCGCCTA-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 6116.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr5-53109714-GGCACAGCGGCACCATCCCGCCTA-G is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MOCS2NM_176806.4 linkc.-8_15delTAGGCGGGATGGTGCCGCTGTGC p.Met1fs frameshift_variant, start_lost Exon 1 of 7 ENST00000450852.8 NP_789776.1 O96033
MOCS2NM_004531.5 linkc.-656_-634delTAGGCGGGATGGTGCCGCTGTGC 5_prime_UTR_variant Exon 1 of 7 ENST00000396954.8 NP_004522.1 O96007A0A024QZS1
MOCS2NM_176806.4 linkc.-8_15delTAGGCGGGATGGTGCCGCTGTGC 5_prime_UTR_variant Exon 1 of 7 ENST00000450852.8 NP_789776.1 O96033

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MOCS2ENST00000450852.8 linkc.-8_15delTAGGCGGGATGGTGCCGCTGTGC p.Met1fs frameshift_variant, start_lost Exon 1 of 7 1 NM_176806.4 ENSP00000411022.3 O96033
MOCS2ENST00000396954.8 linkc.-656_-634delTAGGCGGGATGGTGCCGCTGTGC 5_prime_UTR_variant Exon 1 of 7 1 NM_004531.5 ENSP00000380157.3 O96007
MOCS2ENST00000450852.8 linkc.-8_15delTAGGCGGGATGGTGCCGCTGTGC 5_prime_UTR_variant Exon 1 of 7 1 NM_176806.4 ENSP00000411022.3 O96033

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Sulfite oxidase deficiency due to molybdenum cofactor deficiency type B Pathogenic:2
Nov 01, 2006
OMIM
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: literature only

- -

Jul 05, 2023
Greenwood Genetic Center Diagnostic Laboratories, Greenwood Genetic Center
Significance: Likely pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

PVS1, PM2 -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs397518417; hg19: chr5-52405544; API