NM_181882.3:c.3286_3356delATCCCCGAGGTGGAGCTGGTCACGCTGGGCGCCCAGGAGGAAGGGAGGGCAGAGGGGGCTGTGGCCGTCAG
Variant summary
Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1_StrongPP5_Very_Strong
The NM_181882.3(PRX):c.3286_3356delATCCCCGAGGTGGAGCTGGTCACGCTGGGCGCCCAGGAGGAAGGGAGGGCAGAGGGGGCTGTGGCCGTCAG(p.Ile1096TrpfsTer18) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000933 in 1,608,308 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. I1096I) has been classified as Likely benign.
Frequency
Consequence
NM_181882.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- Charcot-Marie-Tooth disease type 4Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- Charcot-Marie-Tooth disease type 4FInheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Ambry Genetics
- Charcot-Marie-Tooth disease type 3Inheritance: AD, AR Classification: MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 12 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| PRX | NM_181882.3 | c.3286_3356delATCCCCGAGGTGGAGCTGGTCACGCTGGGCGCCCAGGAGGAAGGGAGGGCAGAGGGGGCTGTGGCCGTCAG | p.Ile1096TrpfsTer18 | frameshift_variant | Exon 7 of 7 | ENST00000324001.8 | NP_870998.2 | |
| PRX | NM_001411127.1 | c.3571_3641delATCCCCGAGGTGGAGCTGGTCACGCTGGGCGCCCAGGAGGAAGGGAGGGCAGAGGGGGCTGTGGCCGTCAG | p.Ile1191TrpfsTer18 | frameshift_variant | Exon 7 of 7 | NP_001398056.1 | ||
| PRX | XM_017027047.2 | c.3184_3254delATCCCCGAGGTGGAGCTGGTCACGCTGGGCGCCCAGGAGGAAGGGAGGGCAGAGGGGGCTGTGGCCGTCAG | p.Ile1062TrpfsTer18 | frameshift_variant | Exon 4 of 4 | XP_016882536.1 | ||
| PRX | NM_020956.2 | c.*3491_*3561delATCCCCGAGGTGGAGCTGGTCACGCTGGGCGCCCAGGAGGAAGGGAGGGCAGAGGGGGCTGTGGCCGTCAG | 3_prime_UTR_variant | Exon 6 of 6 | NP_066007.1 |
Ensembl
Frequencies
GnomAD3 genomes AF: 0.00000660 AC: 1AN: 151434Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.00000404 AC: 1AN: 247424 AF XY: 0.00 show subpopulations
GnomAD4 exome AF: 0.00000961 AC: 14AN: 1456874Hom.: 0 AF XY: 0.00000690 AC XY: 5AN XY: 724978 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.00000660 AC: 1AN: 151434Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1AN XY: 73896 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
ClinVar
Submissions by phenotype
not provided Pathogenic:2
Frameshift variant predicted to result in protein truncation, as the last 366 amino acids are replaced with 17 different amino acids, and other loss-of-function variants have been reported downstream in HGMD; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 32376792, 32460404, 18410371) -
- -
Charcot-Marie-Tooth disease Pathogenic:1
- -
Charcot-Marie-Tooth disease type 4 Pathogenic:1
This sequence change creates a premature translational stop signal (p.Ile1096Trpfs*18) in the PRX gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 366 amino acid(s) of the PRX protein. This variant is present in population databases (no rsID available, gnomAD 0.0009%). This premature translational stop signal has been observed in individual(s) with Charcot-Marie-Tooth disease (PMID: 18410371, 32460404). ClinVar contains an entry for this variant (Variation ID: 448139). This variant disrupts a region of the PRX protein in which other variant(s) (p.Gln1169*) have been determined to be pathogenic (Invitae). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at