NM_183065.4:c.*608_*636dupTGTCTGTATCGTCAGGTGGGATAATCCTT

Variant names:

• chr17-8173566-T-TAAGGATTATCCCACCTGACGATACAGACA
• rs1555525654
• NM_183065.4:c.*608_*636dupTGTCTGTATCGTCAGGTGGGATAATCCTT

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5

The NM_183065.4(TMEM107):​c.*608_*636dupTGTCTGTATCGTCAGGTGGGATAATCCTT variant causes a 3 prime UTR change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: TMEM107 NM_183065.4 3_prime_UTR
• Clinical Significance: Pathogenic no assertion criteria provided P:1
• Conservation: PhyloP100: 1.60
• Publications: 0 publications found

Genes affected

TMEM107 (HGNC:28128): (transmembrane protein 107) This gene encodes a transmembrane protein and component of the primary cilia transition zone. The encoded protein regulates ciliogenesis and ciliary protein composition. Human fibroblasts expressing a mutant allele of this gene exhibit reduced numbers of cilia, altered cilia length, and impaired sonic hedgehog signaling. In human patients, different mutations in this gene cause different ciliopathies, including Meckel-Gruber syndrome and orofaciodigital syndrome. [provided by RefSeq, May 2017]

SNORD118 (HGNC:32952): (small nucleolar RNA, C/D box 118)

SNORD118 Gene-Disease associations (from GenCC):

• leukoencephalopathy with calcifications and cysts

  Inheritance: AR Classification: STRONG, MODERATE Submitted by: G2P, PanelApp Australia, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PP5: Variant 17-8173566-T-TAAGGATTATCCCACCTGACGATACAGACA is Pathogenic according to our data. Variant chr17-8173566-T-TAAGGATTATCCCACCTGACGATACAGACA is described in ClinVar as Pathogenic. ClinVar VariationId is 265785.Status of the report is no_assertion_criteria_provided, 0 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_183065.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TMEM107	NM_183065.4	MANE Select	c.*608_*636dupTGTCTGTATCGTCAGGTGGGATAATCCTT		3_prime_UTR	Exon 5 of 5	NP_898888.1
	SNORD118	NR_033294.2	MANE Select	n.-7_22dupTGTCTGTATCGTCAGGTGGGATAATCCTT		non_coding_transcript_exon	Exon 1 of 1
	TMEM107	NM_032354.5		c.*608_*636dupTGTCTGTATCGTCAGGTGGGATAATCCTT		3_prime_UTR	Exon 5 of 5	NP_115730.2

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TMEM107	ENST00000437139.7	TSL:1 MANE Select	c.*608_*636dupTGTCTGTATCGTCAGGTGGGATAATCCTT		3_prime_UTR	Exon 5 of 5	ENSP00000402732.2
	TMEM107	ENST00000449985.6	TSL:1	c.*657_*685dupTGTCTGTATCGTCAGGTGGGATAATCCTT		3_prime_UTR	Exon 2 of 2	ENSP00000404753.2
	SNORD118	ENST00000363593.2	TSL:6 MANE Select	n.-7_22dupTGTCTGTATCGTCAGGTGGGATAATCCTT		non_coding_transcript_exon	Exon 1 of 1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 0

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
1	-	-	Leukoencephalopathy with calcifications and cysts (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.6
Mutation Taster		=32/68	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555525654; hg19: chr17-8076884;