X-147912049-CGCGGCGGCGGCGGCGGCGGCG-CGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCG

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_002024.6(FMR1):​c.-100_-99insCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG variant causes a 5 prime UTR change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

Frequency

Genomes: 𝑓 0.000028 ( 0 hom., 1 hem., cov: 2)

Consequence

FMR1
NM_002024.6 5_prime_UTR

Scores

Not classified

Clinical Significance

Not reported in ClinVar

Conservation

PhyloP100: 0.618

Publications

0 publications found
Variant links:
Genes affected
FMR1 (HGNC:3775): (fragile X messenger ribonucleoprotein 1) The protein encoded by this gene binds RNA and is associated with polysomes. The encoded protein may be involved in mRNA trafficking from the nucleus to the cytoplasm. A trinucleotide repeat (CGG) in the 5' UTR is normally found at 6-53 copies, but an expansion to 55-230 repeats is the cause of fragile X syndrome. Expansion of the trinucleotide repeat may also cause one form of premature ovarian failure (POF1). Multiple alternatively spliced transcript variants that encode different protein isoforms and which are located in different cellular locations have been described for this gene. [provided by RefSeq, May 2010]
FMR1-AS1 (HGNC:39081): (FMR1 antisense RNA 1)

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
FMR1NM_002024.6 linkc.-100_-99insCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG 5_prime_UTR_variant Exon 1 of 17 ENST00000370475.9 NP_002015.1 Q06787-1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
FMR1ENST00000370475.9 linkc.-100_-99insCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGG 5_prime_UTR_variant Exon 1 of 17 1 NM_002024.6 ENSP00000359506.5 Q06787-1

Frequencies

GnomAD3 genomes
AF:
0.0000284
AC:
1
AN:
35175
Hom.:
0
Cov.:
2
show subpopulations
Gnomad AFR
AF:
0.000103
Gnomad AMI
AF:
0.00
Gnomad AMR
AF:
0.00
Gnomad ASJ
AF:
0.00
Gnomad EAS
AF:
0.00
Gnomad SAS
AF:
0.00
Gnomad FIN
AF:
0.00
Gnomad MID
AF:
0.00
Gnomad NFE
AF:
0.00
Gnomad OTH
AF:
0.00
GnomAD4 exome
Cov.:
0
GnomAD4 genome
AF:
0.0000284
AC:
1
AN:
35175
Hom.:
0
Cov.:
2
AF XY:
0.000172
AC XY:
1
AN XY:
5801
show subpopulations
African (AFR)
AF:
0.000103
AC:
1
AN:
9740
American (AMR)
AF:
0.00
AC:
0
AN:
2760
Ashkenazi Jewish (ASJ)
AF:
0.00
AC:
0
AN:
832
East Asian (EAS)
AF:
0.00
AC:
0
AN:
569
South Asian (SAS)
AF:
0.00
AC:
0
AN:
426
European-Finnish (FIN)
AF:
0.00
AC:
0
AN:
836
Middle Eastern (MID)
AF:
0.00
AC:
0
AN:
69
European-Non Finnish (NFE)
AF:
0.00
AC:
0
AN:
19299
Other (OTH)
AF:
0.00
AC:
0
AN:
465

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
0.62

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs193922936; hg19: chrX-146993567; API