X-154030643-GCTCTCGGGCTCAGGTGGAGGT-G

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM1PM4

The NM_001110792.2(MECP2):​c.1200_1220delACCTCCACCTGAGCCCGAGAG​(p.Pro401_Ser407del) variant causes a disruptive inframe deletion change. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. P400P) has been classified as Benign.

Frequency

Genomes: not found (cov: 16)

Consequence

MECP2
NM_001110792.2 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 5.37

Publications

0 publications found
Variant links:
Genes affected
MECP2 (HGNC:6990): (methyl-CpG binding protein 2) DNA methylation is the major modification of eukaryotic genomes and plays an essential role in mammalian development. Human proteins MECP2, MBD1, MBD2, MBD3, and MBD4 comprise a family of nuclear proteins related by the presence in each of a methyl-CpG binding domain (MBD). Each of these proteins, with the exception of MBD3, is capable of binding specifically to methylated DNA. MECP2, MBD1 and MBD2 can also repress transcription from methylated gene promoters. In contrast to other MBD family members, MECP2 is X-linked and subject to X inactivation. MECP2 is dispensible in stem cells, but is essential for embryonic development. MECP2 gene mutations are the cause of most cases of Rett syndrome, a progressive neurologic developmental disorder and one of the most common causes of cognitive disability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
MECP2 Gene-Disease associations (from GenCC):
  • chromosome Xq28 duplication syndrome
    Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
  • Rett syndrome
    Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics, ClinGen, G2P
  • severe neonatal-onset encephalopathy with microcephaly
    Inheritance: XL Classification: DEFINITIVE, SUPPORTIVE Submitted by: G2P, Orphanet
  • syndromic X-linked intellectual disability Lubs type
    Inheritance: XL Classification: DEFINITIVE Submitted by: G2P
  • atypical Rett syndrome
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • non-syndromic X-linked intellectual disability
    Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
  • X-linked intellectual disability-psychosis-macroorchidism syndrome
    Inheritance: XL Classification: SUPPORTIVE Submitted by: Orphanet
  • systemic lupus erythematosus
    Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

PM1
In a hotspot region, there are 5 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 13 benign, 12 uncertain in NM_001110792.2
PM4
Nonframeshift variant in NON repetitive region in NM_001110792.2.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MECP2NM_001110792.2 linkc.1200_1220delACCTCCACCTGAGCCCGAGAG p.Pro401_Ser407del disruptive_inframe_deletion Exon 3 of 3 ENST00000453960.7 NP_001104262.1 P51608-2A0A140VKC4Q59FJ6
MECP2NM_004992.4 linkc.1164_1184delACCTCCACCTGAGCCCGAGAG p.Pro389_Ser395del disruptive_inframe_deletion Exon 4 of 4 ENST00000303391.11 NP_004983.1 P51608-1D3YJ43Q59FJ6

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MECP2ENST00000453960.7 linkc.1200_1220delACCTCCACCTGAGCCCGAGAG p.Pro401_Ser407del disruptive_inframe_deletion Exon 3 of 3 1 NM_001110792.2 ENSP00000395535.2 P51608-2
MECP2ENST00000303391.11 linkc.1164_1184delACCTCCACCTGAGCCCGAGAG p.Pro389_Ser395del disruptive_inframe_deletion Exon 4 of 4 1 NM_004992.4 ENSP00000301948.6 P51608-1

Frequencies

GnomAD3 genomes
Cov.:
16
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
16

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Severe neonatal-onset encephalopathy with microcephaly Uncertain:1
Oct 30, 2017
Labcorp Genetics (formerly Invitae), Labcorp
Significance:Uncertain significance
Review Status:criteria provided, single submitter
Collection Method:clinical testing

In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the deleted amino acids is currently unknown. This variant, c.1164_1184delACCTCCACCTGAGCCCGAGAG, results in the deletion of 7 amino acids of the MECP2 protein (p.Pro389_Ser395del), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (ExAC no frequency). This variant has not been reported in the literature in individuals with MECP2-related disease. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
5.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1557135539; hg19: chrX-153296094; API