X-24364256-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC

Variant names:

• chrX-24364256-T-TTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC
• rs35206911
• NM_001136234.3:c.1516_1551dupGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_001136234.3(SUPT20HL1):​c.1516_1551dupGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT​(p.Ala506_Ala517dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: 𝑓 0.000012 (0 hom., 0 hem., cov: 2)
• Consequence: SUPT20HL1 NM_001136234.3 conservative_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.334
• Publications: 1 publications found

Genes affected

SUPT20HL1 (HGNC:30773): (SUPT20H like 1) Predicted to enable transcription coregulator activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to be part of SAGA complex. [provided by Alliance of Genome Resources, Apr 2022]

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001136234.3

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001136234.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SUPT20HL1	NM_001136234.3	MANE Select	c.1516_1551dupGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT	p.Ala506_Ala517dup	conservative_inframe_insertion	Exon 1 of 1	NP_001129706.3	A0A7I2YQ69

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	SUPT20HL1	ENST00000686983.1	MANE Select	c.1516_1551dupGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT	p.Ala506_Ala517dup	conservative_inframe_insertion	Exon 1 of 1	ENSP00000509731.1	A0A7I2YQ69
	SUPT20HL1	ENST00000436466.2	TSL:6	c.1516_1551dupGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT	p.Ala506_Ala517dup	conservative_inframe_insertion	Exon 2 of 2	ENSP00000502907.1	A0A7I2YQ69

Frequencies

GnomAD3 genomes AF: 0.0000122 AC: 1 AN: 82147 Hom.: 0 Cov.: 2

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000223

Gnomad OTH AF: 0.00

GnomAD4 exome Cov.: 18

GnomAD4 genome AF: 0.0000122 AC: 1 AN: 82147 Hom.: 0 Cov.: 2 AF XY: 0.00 AC XY: 0 AN XY: 19279

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 17324

American (AMR) AF: 0.00 AC: 0 AN: 7819

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 2061

East Asian (EAS) AF: 0.00 AC: 0 AN: 2799

South Asian (SAS) AF: 0.00 AC: 0 AN: 1390

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 4177

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 200

European-Non Finnish (NFE) AF: 0.0000223 AC: 1 AN: 44743

Other (OTH) AF: 0.00 AC: 0 AN: 1068

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		0.33

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs35206911; hg19: chrX-24382373;