X-67545316-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA-TGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant names:

• chrX-67545316-T-TGCAGCAGCAGCAGCAGCAGCAGCAGCA
• rs3032358
• NM_000044.6:c.213_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCA

Variant summary

Our verdict is Benign. Variant got -12 ACMG points: 0P and 12B. BP6_Very_Strong BS2

The NM_000044.6(AR):​c.213_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCA​(p.Gln72_Gln80dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as Likely benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0018 (2 hom., 5 hem., cov: 0)
  • Exomes 𝑓: 0.00067 (0 hom. 42 hem.)
  • Failed GnomAD Quality Control
• Consequence: AR NM_000044.6 disruptive_inframe_insertion
• Clinical Significance: Benign/Likely benign criteria provided, multiple submitters, no conflicts B:4
• Conservation: PhyloP100: 0.337

Genes affected

AR (HGNC:644): (androgen receptor) The androgen receptor gene is more than 90 kb long and codes for a protein that has 3 major functional domains: the N-terminal domain, DNA-binding domain, and androgen-binding domain. The protein functions as a steroid-hormone activated transcription factor. Upon binding the hormone ligand, the receptor dissociates from accessory proteins, translocates into the nucleus, dimerizes, and then stimulates transcription of androgen responsive genes. This gene contains 2 polymorphic trinucleotide repeat segments that encode polyglutamine and polyglycine tracts in the N-terminal transactivation domain of its protein. Expansion of the polyglutamine tract from the normal 9-34 repeats to the pathogenic 38-62 repeats causes spinal bulbar muscular atrophy (SBMA, also known as Kennedy's disease). Mutations in this gene are also associated with complete androgen insensitivity (CAIS). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]

ACMG classification

Verdict is Benign. Variant got -12 ACMG points.

• BP6: Variant X-67545316-T-TGCAGCAGCAGCAGCAGCAGCAGCAGCA is Benign according to our data. Variant chrX-67545316-T-TGCAGCAGCAGCAGCAGCAGCAGCAGCA is described in ClinVar as [Likely_benign]. Clinvar id is 422605.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High Homozygotes in GnomAd4 at 2 XL gene

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AR	NM_000044.6	c.213_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln72_Gln80dup	disruptive_inframe_insertion	Exon 1 of 8	ENST00000374690.9	NP_000035.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AR	ENST00000374690.9	c.213_239dupGCAGCAGCAGCAGCAGCAGCAGCAGCA	p.Gln72_Gln80dup	disruptive_inframe_insertion	Exon 1 of 8	1	NM_000044.6	ENSP00000363822.3

Frequencies

GnomAD3 genomes AF: 0.00179 AC: 119 AN: 66636 Hom.: 2 Cov.: 0 AF XY: 0.000606 AC XY: 5 AN XY: 8246

Gnomad AFR AF: 0.000852

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00306

Gnomad ASJ AF: 0.00408

Gnomad EAS AF: 0.00486

Gnomad SAS AF: 0.00110

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00190

Gnomad OTH AF: 0.00499

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.000674 AC: 631 AN: 936887 Hom.: 0 Cov.: 40 AF XY: 0.000142 AC XY: 42 AN XY: 295033

Gnomad4 AFR exome AF: 0.000463

Gnomad4 AMR exome AF: 0.00120

Gnomad4 ASJ exome AF: 0.00301

Gnomad4 EAS exome AF: 0.00332

Gnomad4 SAS exome AF: 0.000819

Gnomad4 FIN exome AF: 0.000580

Gnomad4 NFE exome AF: 0.000472

Gnomad4 OTH exome AF: 0.00123

GnomAD4 genome AF: 0.00179 AC: 119 AN: 66623 Hom.: 2 Cov.: 0 AF XY: 0.000605 AC XY: 5 AN XY: 8259

Gnomad4 AFR AF: 0.000851

Gnomad4 AMR AF: 0.00306

Gnomad4 ASJ AF: 0.00408

Gnomad4 EAS AF: 0.00488

Gnomad4 SAS AF: 0.00111

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00190

Gnomad4 OTH AF: 0.00493

ClinVar

Significance: Benign/Likely benign

Submissions summary: Benign:4

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Inborn genetic diseases Benign:1

Apr 05, 2024

Ambry Genetics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. -

Androgen resistance syndrome;C1839259:Kennedy disease Benign:1

Oct 21, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not provided Benign:1

Feb 12, 2021

GeneDx

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant is associated with the following publications: (PMID: 2062380) -

Androgen resistance syndrome;C0268301:Partial androgen insensitivity syndrome;C0376358:Malignant tumor of prostate;C1839259:Kennedy disease;C2678098:Hypospadias 1, X-linked Benign:1

Jan 06, 2022

Fulgent Genetics, Fulgent Genetics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs3032358; hg19: chrX-66765158;